Description :
From Genome Similarity Track
Location :
Scaffold_322:883575- 884884
Sequence
1309 bases(100 bases per row)
TATTGAACCGAGAAATTGAATTCGGCGAAGAAGGAAAGCCAGCGAGTCATGCGGGCTGACATGTGGGGTGTGTTGACGGCAGTTCGCAACGACGCGTGGT
CGGTGTATACGACGAAGGGGTCCGCGCCGATGAGGTAGACGCGGAACTTGGTGAGGGTGTACTTGGTCAAGAGGAGCTCGAGACCATGGACCGTGTACGA
GCGCTCGGCGGCGTGGAGCTGGCGACTTTGAAAGGATACAGGGCGCCAGCGACCATCAGCGTCAGGTTGCATTAAGCAAAAACCGATAGCGTATTGGGAA
GCGTCACACTCGACGTTGAACGGCCTGGAAAAATCAGGCAGCGCCAAGCCAATAGTGGCGCTCTTGATGCTAGATTTAAAGGCGTCGAAGGCGAATTGAC
AGTCGCTGGACCAAACCCATGGACATCCTTGACTAGCAACTGAAAGAGGGGTTGCGCGATTTCAACAAAACCACGAGAGTACTTGTGGAGGTGAGTAGCC
AAGCCAAGTCACCGGCGAAGGTCGGTGACCGAGGAGGGGACTGGCCAGTCGACGATGGTCTTGACTTTGTCCGGATCAGCCCGACAACCACGAATGCCGA
CGAGGTCGCCAAGTACAGGGATTTCGTCGAACCCAAACTGACATTTCGAGTGGTTGGCGTACAAGCTATTCTCACGAAGGATGGTTAGAACCACAGGAAG
ATGCCGACGGTGAACTGCGACGTCAGTCTCGGTGTCAGAACCGCGAAATAGGACAAAGTCGCGGAGAGGGCGGAACTTGGCCGTCACCATGCGATTGAAA
GTCGCAGGGGTATTGGATAGGCCTTGGGGGATTACGAGCCATTCCCAAAGTATTCCACTTGGTGTCGAGCGGCGGTCTTCGGCACGTCACAAAGGCGCAT
GACGATTTGATAGAATCCATCGCGCAGGTCGATGGTCCAGAATATGGTGGATAATCACATCTTTGCGGGGGATCGGTGTTTGCTCCGGAATGGTGGCGGC
GTTGAGCTTGTTAAGGCATTTGCCGTTAGGTTTCTTTACACAGATCGTCGGGCTGCTGTGTGGGGACGTGCTTTCGCGTATATGGCCGGCGGCTTTACGA
GCCGCAAAGAAGGCGTCAATCGCTTCGACTTGATCACGCTGGAGAGGGCATTGGCGAGTAACGCAATATTTCGTGCCGCGCACAAGGTTAATTTCATGGC
GTATACCCTTGTCGACGGGTTGTCGACAGGGAACGTCGTCGGGAAATACATCCTTGAATTCATCAAGGACGTCGAAGAACGGATTCGAGCGGAGGGAAGC
CCATGCCTG