Description :
From Genome Similarity Track
Location :
scaffold_44:88356- 97459
Transcript NameFunction/comments
g9778.t1 hypothetical protein PHYSODRAFT_557569
g9779.t1 hypothetical protein PHYSODRAFT_360117

Sequence
9103 bases(100 bases per row)
CTTCAGACATGCGCGCATTTACATCCGTGCTGACAACTGAATACCCAGAAGAGTTAGATATCCCATGGTACGATGTCGCGGAGCTTGCAAAGGCTTTGTG
CGACCCAAACAATCCACTCACGAAATGTGCTCGACGCCTACGTGTATGTTTGCTAAGGCGCATGGTTCCCGCAGTCATCTTTTTAGCTGGCACTGCTCCT
AACTTTGAGTACTACGTGGATGCAATTGTGAAGATGCTGGAGGACTGGGATATATCGGGATGAAGTCACCGTATTCCAAATTCTGTAAAGAATGTAGGAA
ATTTCACAACCAACCCATTTATCGACAATGCCAACCCTTACTCATGAAGTGCAAAGCTGCATTCCTGAGTGTGCTCCACTCTCCCAGAATGTTCATGCAA
GAGCAAGAGAAGAGAAGGTGGAAGAAGTCCGTAGGGTTTGTGCCGCTGGGGTGATCGAGCAGCGCGTGCTGTCGGATATTTTTTTGTTTGCGGCCCCGCG
TATTATCCGACAGGTATACTTTTCGACGAACCAGCCGATTGCCGAAGAGGATGAACAAGGAGGATAAGCCCAACAAGAACAAGGAGGGCAGACAGCCAGG
CAAGGATAGTTTGGGCGGGAGGTGAATAAGGAAGGTTGAAAATCGCTAGCTGTAGTTGAGTCATCGAGTGACTTCGCCCCTCAAACGAGGACCAAGTATC
CCAGACACTTGACATTTTCACAGCTCAGTCTGTACTCAAGTCATTAAACCGGCATAGCTTTGGTTGTCTGAATGATGGAGAAATGCTGACATACAAAACC
AGTTGCCTTGGTGCTTCACAAATATAGCAAAGTATGCTCAGTATATCTGTGGTCGAACCTCGTAGCCTCGAATTCCAGCTACCTGCGCGCACCACAAACG
CACCACGTATGGTCCACATTTATGGTACAAGTTGAAGTTAACCCTCACTCACGAAAATATTGTGGTACAAGTTGAAGTTGACCTTCACTCACTGTATCTG
GTCTCACATGATTTCCACCCACCTTCGGACTTGCCGACACTGACCATTCTCCAACTTGCTTCCGAGCAACCAGCCACTTCACCTCAAGGCCCACCACTTC
GCGGAGATCATGATCAACCTCGTGTTCCTGCTCGACATCACTGGCTCCATGGGCAGCGAGCTGGAAGGCGTGAAGGAGACTGTGCGCCACCTCGTTGCTT
CGGTGTTTGAAGAGGAGTACGCTGTCATGATCACCATCATCACGTTTACGGAGAGCTCGCAAGGCTGCTTCGTGACGAACCACAGCTTCACGGAAGGGGA
AGAGGCGATGGACTTCATCACCTCCGTGAAGCTGTGCGTCCCTCCTGGCCACCCGAGTGTGAGTGCCAACGGCGGAGACGGCGATGAGAACCAGAAGGCA
GCATTCGCAGAGCTGCTGACGCTGGACAGCACCATGCCCACGATCGCCTTCCTGATCACAGACGCAGGCCCGCACCTCCTCGCGGAAACCAGAACGTGCG
AAGCGGAGCACGAGATTAACTTCCTCAAGGAGAAGCACTCGATCGTGGACTCGGACATGTTCAACGTGCTCGCCTTGGTGCAGGCGCACTTTGAGGGGAA
CCTCATCGTAAACGTCGTCAAGTACGTCAAGAACAGCGACCACAGGATGTACGGGAGCATCGCCAAAACGTTCGACGGAGTGCTCATCGAGCCCAAGGTG
CGCGCCGCCACGCAGCTAGCGGCAGGGCTTATGGTCATCCTCTCCAAGATGTTCGATCGCTGCGCAGGGGGGACTTTCGAGGTTGCCGCTGAGGAAGAGG
CTCCCAGCGAGACGAGCTTGGACACGTTCATCTTCTACGACCTGGAAGGCTTCAGCGTTCCGTCTTGCGAGGCAGACGTCAAGAACAACGCGATCCCGGT
GGCAGGAGACACGCGCGACGTGCTCTTCGCCTTCCTTGACCGAGCTACAGTCGTGGTTGGTGATCGGTTCGCCAAGCGTGCAATCGCAGCGTCAGGCTTG
CGCGAGCAGGTTGAGTTGTTGATCACCATCGCACAGTGCCTCACGGGCAAGCTCGGCTACAACGACGCCCTGGATCGCGCCACATCTCTCGTCGAGACGA
TTCGCGACTTGCTGCCGGACGAGAACCAGAACCACCTGAAGCTCACCGCCGAGTCGCTGCCTGGTGTGCTGCAGCAAAAGATCACCACGTCCAGCGAGCT
AGAGGCGTCCATCAGTGCTATCACACTGCTCACGACACAAGAGGCGACAGAAGATGCGCTGGAGGAAGACGACGTCTTCGACCCGAAGACGGTTCTGCAG
ACAGTGGCAAGCTTGTTCCTGGCCCACCTCGCCGTGCTGCAGCTCCCGGAGAAGAACGGCAAGCCGGACTTCATGGACGCGTGGTCGGCCGTCATCACCA
AGGTCTCCCCGGACGTAGTCACAGCGCGTGACTTCCTGACACTCATCGGCAGCGAGGAAGCCACCGGAGGCCTGAGCATTCGAGCCCGGGACTACAACTA
CGCACAAATGGTCGCTGACCCGGACGATGCGCTGGGTAGCGCTCTAGTGCGCGCAGCGTCAGGCACGCAGGTGCTTGACATCCTGACGGGGCTGCTGTCG
GGTGCTCCTGCAGGTCTCTTCTGCCCCAACATGTTTCGTGGCACAGTGTCGGCTTCGCTGATGGCCCTGCTCGAGCAGCGAGACGAACCCTTGAGCGATT
TCCAGTGGGAACTCGTGGCCAAGCTCGTGCACTCGATCCGTCTCGTCATGACCAGTGTCAAGCCCCTGCCGAAGATGCCGGTCAACCCGGAAGACGCTGT
GGGGAAGCTGCTGTTCTTCCTGCTTCGTCGTTCGCAAGAGAAGTACGACGGCGAGGCCCTGCTGGCAGTGCTGAAGGAGCTGCTGGCTACGCGTGTACAC
AAGTTCATCAGATTCAATGAGGCTCGATACCTGGCGCTGGTGGAGCGTATGGTCGGGTACACGCACGAGAGCGTAGTCGAAGACGCCTTTGACCCGCACG
CGCTGGACCAGGACGTCTGGAGGTTTGGCGCGAAGAAGGCTGGGCGGTTCGCTGCCACGACGTCGTTCTTCCAGGCGTTTGAGCGCTGTGCCAACAACCT
CATCCGCTGTGTGGCAGTCTCGCCGAAGAAGTTCAAGGACGACACGCAAGTGGTGCCGACGTTGCAGGAGGTGTGGCCCACGTGCACAGAGGAGCTCCCC
AAGTTCCTCCTGCTGCAAAAGCGATCAGCGCGCTACCGCATCGTCCGAGATGCAGCCGCGGCGGATGGGAAGATCAATTGGGAGCTGAACCACACCTTGG
ACGAAGACCTCGACAGCGCGACGTACGAGAAGCTTGCCATGCAGCTTTTGCGCAGGAAGTACGACGCGTTCCTTCGGGAGCTGCGGGAGCGTCGCGCCAA
CGAAGCGGCCGAGCAGAGGTGGAGCCGAGCGCTGAAGACAGCGCGGGCGTCGTCCATGGAGGCGTTTCTGGAGAAGCTGGCGCTCATTCGGGATTCGGCC
AGCCAGGAGCACAAGCTGCTCTGGAAGGCGCTGAAGCAGCTTGGAGCCGGCGAGAAGAACGAGGTCGAGCTCTACGAAGAGAAGCTGGAGGTGCTGATCA
CGGGCCGGCTGGAGGTGCGTCGAGGGGAGTTCGACGTCGTCTTCAACCGTGGAAACCTGCACCCGCACCCGGACAAGCTTGCGCCCATGAGTGCAGAGCT
CCAAGCCAAGCTGCGAGAGCTCCGTCGCAAGTACGACTGGCCAATCCGCCACAAGTACCGCGATGGCAAGTCCAACCGCAATGGCCACTCCAACGATACG
CCTTCCGAGTGGGCGAAGAAGCGCTCCGATGCCGAGAAAACCTTCTGGGAGGACAACTAAGACACTTTACATGGTGTACAAGCTCAAATATTACTTTCCA
TGTCAACTTTTTGTAGAAGCTCAGCAGTTAGAAACTGCCCTTGTGTTAGAATGTAGCAATTTCGAATGTAGAAACGCTGTAGCCATTTGCCAAATTGAAG
CTGCTGTCACACAAGCTCAACAGTCTGTCAGTTGTGTACCGATAGCTGGATGCCCGGGGAGAAACGGCATGTGGCGGGGTTGCTGGGGGAACAGGAAGCG
CTGGGGGCCAATTGGAAGTCGGCGCAGTGCGTGACGTCTCTGTATGACTCGTACATTCAGCTGCAGCGAGAGAACGAGGAGCTGCGTGAAAATGGCCGGC
GGCTCCAGCAGGAGACCGAGCTGCTGGCGGCGCAGAGCAAGCAGAACAAGCTGCGGGACCCGGAGGACACGAGATGCGAGGAGTTGGAGCAGGAGATTCG
GCTTTTACGCAGCGAGAAGATGCGGACGGAGGAGGCGCATCGCCTTGAGCTGCAGAAGACGGAGGCGAGAGCTGCGCACAGCGGGGCGACATACCAGCAG
TTGGTGGCCAAGTACCAAGAGAGATTCGAGTTCGACCCTCTCGAAGCCAAGCGAGCTGCGATGGCCGTGAAGACCATGCAGAACACGCTGCAGAACGCGG
TGCTGGAGAAGGAGGAGCTTGGCATTCGGCTTGGTGAGCTGGCAGAGCAGTACCGCAAGTTTCAAAAGGACCAAGTGGAGATCGTGCAGAGTTTGAAGGA
GCGAGTGAGAGTGTACGAGCAGCAGAGAGTGAGGGCGGGCCAGCAACGTGTCGTGAATGCTTTATCACTGTGGTCGACGAGTCAAATTCAGAGTGCGTGG
AGCAAGTGGATCGCGCTGGTAAGGGAGCAACGACAGCGAGAGCAGCACAACAAGTTGGTGACAAGTCTAGAGGTTAAAGTTGACGAACGAGTTGCTAAGC
TTCAAGGGAACCAGGCGGCTCTGCTTGCGATGAAGCTGCTACAACAGTCGGCTAGACGGACATTTATTCGATGGCGAGATCTCATGCGGCAGAACGTGGA
GAGGCGTCGCAAGGAGAAACGTTTTACTGAAGAGCGTAGCCGGAAAAGAGTTAAACGGGTGGTGAAATGCTGGCGAATGGAGTGTCAGAAGGCAGTTTCT
CATCGTAGTGGCATGCTGAAGATCGAGAGACTTCTGACTGGCCGTTCACGTCGTTGGGGTATGCGGAAGTGGAGCGTTCAAACCTTTCGTCTTGCTTTGG
CCGAGAAGGACAGACGGCTGGATGTGTTGAACGGAACGACGGGACTGCAAGTCAAAACTATCGTGAGTTTAGAGGGAGCACTTGAGGACGCACGAAAAGG
AATTCGAGAAAGACAGGAGCAATACGAGGAAGAAAAGGCCAGGTACATGGCAAGTATTGAGACGCACAGAGCTACTGAACTAGCGATACGACAGAAACTG
GGGCGCTTCTTTACCAAGCAGTCCGACCGACAGCTTCTGAAGGGTGTTCTGCGTGAGTGGAAGATGACAGCCAGGTATCTACAAGGTATCAACCAACGCG
CTGACGTGGCTAGAGCAAAGCTCCGGATACTTAAGCTTCGACGATCCGTGTGCGACTGGCACTGTACAGCGCACCAGAGCAACAAGAAGCGCACACACAC
CCAGCAGATTCTTGCTCGCATGCGCCAGATCGGCGTTCTCAAGTGCTTCAACTCGTGGAAAGAGAAGGCTAGAGAGAAGAGTCTACGGAAGATAGCTCTG
CTGCACGCAGTCAATCGGATGCGGAACCGAGGAGTAGCGCGGTGCTTTACGCAGTGGGCAGCGTTTTGGCAGCAGCGAGCATCACTTCGACAAGGAATTG
ACGTGATGGCAAAATGTGCGATGAAGCAGCAAGCGTTTTTCATGTTCCGCTCGTGGAAAGAGCGAGTTGCTCAACTCAAAATTGAAGCTCAGACACGGCA
GCAGGAGTTGATTCAAAAAGCTTGGGAGAGTCAGCTGGCTCAAGCTAAATGGGACCTAACCTTCCAGCGAGCGTGCTTCAGTCGCTGGCATGACGCGGTG
CTTCGAAGACAGAGACAGGATGCAGTTGTGAAGAAGTGTCTAGCGCGCATCAAAAATGGTTCGTTGGCGAGAGTGCTCGGAAGCTGGCGCGAATTTGTCG
AGTCCCGCAAGACACAACGAGAGCTCGTGCGTAGATGGGTAGGTCGCTGTCACGCTGGAGTTCTACAGCGAGCGTGGAATCGATGGCAACGACAGATCGT
TCTGAAAGAGCAGCAGATTTTAATGCTCCAACTCCAGGAACAACGAGACGCTGAGCTGGAAAAGCTAGCGACAGAGTTTGAAGAGTACCGAAAGGCACAG
CAACTATTGCTTCAAGAAGCTGAGCAAGCTCAGACACAGCAGGAGAACAAACTGCAGGCGACGAACGCTCGCCTTTACGAGGAAGCAAAGCGAGCACAAC
GATTGACAGGTGCTGTAGAAATGTTGTGTATGACTAGGGAAAGAGGTTCTACACTGGTACGATGCTTCAAGGTGTGGCAAAAAGTCGTTCGCCAAGCTGT
TTACGCTCGTAGACTCGTGCACGATTTCCAGACCGCAGTGAAAGTCCACCAAACTCGTGCAATTTTGTCAAAGTGGAAGCGATTCAGTACTCAGCAAAAA
CGCTGGAAGGCCGTTCACAGGACGATTCAGTCCTGTTTCTCGCGTTGGTGGCAGATTCAATGCTTGGAGGCTTGGAAAGAAGCCAGGCGACGGCGCAGAG
CAGTACAGGTATTCTCAACGTTGTTTGTCCGCAACTCGGAGACGTACATCTGCCGAGGAATTGTTTCGGAATGGAGAAAGCTAGCTAGAAGGAATGGCTT
GCTGCGTTGGACGCTAGAGAAAATCTGGCTGGGGTCTGTTCATGCGAAAATGCGGCAACAATTCACGCACTGGGCAGCGCTTACGAGGGCGGAGGCAGCA
AAAGAGCAGGTTGAAAAACGAAATGTGGCGCTTACTGCGATTCGAGCGAAGGTTTGGTGGAAGCAATCGGTATCAACGATGCGCTGTTGCTTTTCCGAGT
GGAAGGATACCGTCAAGAGTAGAAAGACGCGTCGCCAAGCAGAGCGAAAACTGATGCTGTTCCAGCAGACGCGCGTTGCACAGCTGTGCTTCAGCGCTTG
GGCGGAATTTGTGCTGCTTCAAGGCCGAGAGGAAGAACGCAACCAACGCTTTCGATGCTGGATACGCAAGTTTCTGCGGAGAAAGCAGGAGCGTGCGATG
GCGTTATGGAAGATGCTGCTCATCCGAAACCAACTTCGTGCTCTCAACGAGCTAAAGAAGTTGAAAAGCGCTCAACAAGAAGAACTGGAGCGGCAGAGAG
AGGAGATATCCGTCCTGAAAGAAACCGCGTCTGAAACGCAGAGCAAACTTGCCAACGTCTTCGTTGTGCATGATGAATCGACGACCAAAATGCAGTACTT
GACAGAGTGTGGTTTGGTGGCGAAGTATTTCAACGCACTGAAGTTGAAGCTGTCCATGACACAATACCAGCGCCAGGCAGTTCACTTTTGTCAGAAGAAC
GCTCGTCGACGGCACCTCGCAGAGCTCTTCTCCAGCTGGTACTCATTTTCCCAGAAGTGCCACGCTGTGAAGTTGACTGTAGCTCAGAAAGCTAGACGTT
GTCAAGATGTGCTCACCCGTACCGCTCTACGAGAATGGCAGCTCGTGACCTATCAGCATCGTGTCACCAAGCAAAAGCAGCTCAAGCTAAGACAGCGAGT
ACGGTCTCGCAGACTGATAACGACTTTCGTGGATTGGCATCGATCAATTCTTCGCCAGCGGGTCGTCTCCGTAGCAGTGGATCGTCTGGAAGGCATTGCG
CAGAAGCAGAAACGAAGGAGCTCGCTGTCGTTGTGGCATCAGAAGTGCTTACAGGAGAAAGCCCGGGAGACTCGAGAGAAGGAAAAACGCAAGAAAATCA
TGCAGTTTCTAATGGGTAGACAAGAAGCAGGGCTCGTGCGCACCTTCCACTCGTGGAAAGAGCTCACCCAAATCAAAGCTGCAATCCGCTCTCACGCACA
AGTCCGATACTCGAAAAAGCGTCACGACATTCTCGCTGAAAGTTGGAGATGCTGGCGCTCAACTGTACAAACGGTGAAGCTTCAGCGGAAGTCTGTTCAG
ATTATCCAAGGCTTGACAACGCGATTTTACTGCCGTATTGCCCTGTCGAGATGGACGCGGTATACTTTCATGAGCCAGATTGCACTGTTGCAGACTAGCA
ACGCAGCTCTAACAAGCCAAGTTGAGGAGTCGAGTCACCGCTTACAAAGCACAAGCATGAGCGTAGACCAGCTTTCGACTGAACTAATGCAGCTTCAAGA
CAAGCTTTACGAGGCCGAAGCGAGATCGTCGGCTGTGAGTTTGGAAACCAGTGCTCAAACAGCAAACCGAAACAAACGGTTCACTTGTCTGGCCAGCCTC
AGTAAAATGTTGCTGAAGCGAACGGTATCCAGAGAAGTGTCGGAGGCATTTACGTTGTGGAAAGGAAAGCTCTACGATTTGCGAAGGAAACATCAGGCGC
TGGTGCGTGCAGTTTTGATTCGACAGAGGAGAAAGCGGTGGCTTGCATTTTGGCTGTGGAAGGTGAAGACGCTGCGATTGCGGCAGCTTGAGTCTCTGAA
GAAGCTGTGGGGAAGGAACAACCTGCTCTCAATTGTGAGGAAGTGGAGAAAGCATTCCGCAGCTCAGGCCAAGCTGAGGCTCTTCCTTACTAGGCGCTGC
CTACTTTCGTACTCAACCCAGTGCTTGCCCACATCGATTGCGTTTCGACTGTGGAAGACCAAGTCGGCAGAAATGACCGCGCTTCAGCAGGTGACAGCTC
TTCACGCGAGACTTGAAAGCGAGCAGTACTCGTCGTCCACGCATCTACGAAGACTAGCGCTGGGTAGATGGTGTTGGATAGCGTACACCCATCGCCTACG
CCAAATGCGGTCGTTCCTCTCGCGCTGCTACGCGAATTCGACCAAGAGGAACGCTGTTAGACATCTCCGCGTCGTTGAGGCAATGCAGCAGACCAATGAG
GCTGCGCTAACCAAGGCGAAAGAGCAGAGTGAAGCTAGAGCTCAGCAGGAAACGGGGGCTCTGTCGGCGGCAGAAGAGCAGTTGTCTGCCGGGGCTTCTT
TTCAGGCGTTGCAGACGCTCATTCGTCGTCTCTTCCAGCCGACGACCATGAAAGACCTGTTTGTTAGCGTCACCAGCACCTTCGCGCAGATTCTGCACGG
CAG