Description :
From Genome Similarity Track
Location :
Scaffold_269:8835- 13141
Sequence
4306 bases(100 bases per row)
TTATCCAAGACTTTGCGGTCTATGGAGCAGCGCTGTACCAGCTTAAGGACGAGGACTTCCAGCCCGGGGGGTGACCTCATCGCGGCCAAGCACAGCTTCG
CGATGCTCCAACAGAAGGTTTCGGCAGCACCGATACTACGACACTTCGACCTGAAGAAGGAAGTGCATGTCATGTTGTTCGCCAACGAGTGGGCTCTAAG
TTCCACGTTGATGCAAGAGCACGAGGGCAAACTACACCCCGTTCGCTTTTGCGGACGGGTTTTGAAGGATGCTGAGATGAATTATCACCCGGCCGAGAAA
GAGGTCCTCGCGCTTCTGCTGATACTGAAGGTGTGTTATACTCAACTCGTTGGACAGCGAATCCGGGTCTACACTCGGTTTTCGACACTCGACTAGGTCC
ACAAGTCCAAGACATTGTTCGGTCGGGCTACCCAGTTCACCGTCTTGCTGTCGCCGTGGCACCTGTTGGTCGAACGAGTCAAAGAAACCGAGTGTTCGTT
TGCTCAGCTACTTCAAACCGGCTTGACGAACTTCGTTGACTTGGATAAGTCACTGGCGTTGGTCACACCCCGGACACGAGGGTCACCAACTGCTCGTTTG
GACCCGCATCCGCTCTACGCACGCCTACCGCGGTCCTACCGAGGCTTCGTTATGTCGTTTGACGGGTCTGCGAAGACCGAGAAGAACGGTGGATACGGCA
GTTGTTCGTGGATACTATGGAAGCTACCAGACTGGACAGTAGTGCTTGCTGCGAGCGCTTACCTCGAGAACACCACGGTCAACCTCGCTGAGTACACCGG
GATGAACAACGGCGTCTCTGCTACATTACAACATGGAGCCGACGATCTAGTTGTCGTTGGCGACTCGAGGCTCGCGATCCAGCAAGCCCTAGGGGTGATA
GCCTGTCGGAAGGAGTCATTGCTGCAACAACTCTGCCACCACCAAGAACTCACGGCCAAGCTTCGGTCGGTGAAGTACCTGCATGTGGTGAGAGAGTTTA
ACGCTGCGGCCGACTCTCTGGCAAGCGAGACTCTCGAGTGCAAGGAGTATACGGTGGTATCGTCGGACGACCGAGTATTAGAGCTGATGAAGCTGAACCG
TATCGCTGAAGTCATCTACGAGGCTGCTGACGGGTGCGTCGTCGAGGACATACCCTCGGCCAACACAGTATGGGCCGTGGTAGCTTCTGCCAAATCTCGT
AGCAAGAATTTTTTCGATTTTGTGCGAAGAGAAACCGACCGCAGACGGCAGAACAAGACTGAACCCGGACACGTAGCTGTGATGACCAGACGTCAAACGA
GAGCACAGGAGAAACACGGCCGGTTTGCAGATGAAGTCTCGGTCACCGATCAGGGAGACGCATCTCACCGAGTAGAAGCCAATGGTGTGCCGAACGAGTC
TCAAAATGAAGCAGAAGCTTCACCGCTGCGTGCCGAGACGTCACCAGCCCCCCCGAACGCAGAAGACATTGACCCGCTGGTAGTACAGGAAGAACGCTGA
AGGAGAATCGCCTCCGCTCAAGATGAAGAGTTACGGTGGTCGAATCTGAAGGCAGTGCTCCGGGGAGATGATGCGAAGATTGGATACAGAGCAGCACGAG
ATGCATGGAAAATGGCGGACCAATTTGTGTTGAGCGAGGACGATGTGCTATATTACACAAGAACGAGCCGTCGTTCAAGTGACGGCGAGCAAGCCAAGTT
GGAGATGAGACTCGTGGTGCCCACAACGATGATCCAAGAGGTCCTGCAAAGCTGTCATGACTCACTTGAAGGCGGTCATCAAGGTATTACCCGTACGCTA
CATCGAGCGGCGAGAGACTATTACTGGATCGGCCAGTATGCCGATGTGGAGAAACACGTTAAGTCGTGCCCTGACTGCAGTTCAAGTAAGAGCCGACCTC
AGTTCCGCGGGTACTCGCCAGGGAACATCCTAGCCGAGAGACCCTTACAACTAGTCTCTATGGACTTCGTGATACCGCTACCGAAGAGTCGCCGTGGCAA
CACGGCTCTCCTGCTATTCCAATGCTCGTTCACGGGATTCGTGGTGGTCAAAGCCATGTCTGACACTACCGCCTTACTCGTTGCGCAAGCTTTCGAGGAG
TGTGTCTACCGACGTTTTGGAGCACCGTCCTTGATCCGTCATGACCGAGATCCTCGATTTATGAGCGAGGTCTTCCAAGCCTTCGCGGAAATGATGCAGT
CTCGGTCGAGAGCGACCCTGTGCTACCGCCCGCAGGCCAACGGCCAGCAGGAGAGATCGGTGAAGACGATCATGCAGTCAGTCCGCGTATACGCTGAAGA
CCCACTACAGCAGCATTGGGACGAGATCGCCGAAAGACTGATCTTCGCCATCAATAGCTCCCGTGATACGACGAGGAAGGAAACTCCGTTTTACCTCGTT
CATGGGTGGGATGCACAGTCGACGCTCAAGGCAATGTCCTCGTCACTCAAACGAGGCTTCGGTAGCCAAACAGACGTGCTAGCATGGCGCCGAGAGGTCA
ACCGACAGCAGGAAATCACCCTGAGGATGGCCAAGGAGTACCAAGCCGCGGGAAAGGCTCGGAGAGCTGAAGAGCACAATGCGTCGCTTGGCAGGAAGGA
GAAGGAAGTCATGGCAGGCGTCAACGAGAATAGAACCTCGGTCGACCGGGCACCGAGTTCCCCTGACCATAGTAGAGCTGCAGTGACCACTGCAGCTCTA
CTAGAGAACGAGGATCTCTTTGCAGCCCGGGAGCAGAGTGTGGCTGTACATGGAGCGGGTTCGACCAGGACTGACCAAGAAACTAGCTCATCGGTGGCAC
GGACCGTTCCGCGTGAAGAAGAAGGTCGACGAATTTGCGTATGAGTTGGAATTACCCGACCGAAGTGGATACCGGTTCTACCCGGTGGTGCATGTTTCAC
GACTCAAGTCAGTGGACGAGTTCGAAGGCCGACCGAGGGTTCGTTTGGCTCGTGAGGTCACCGAAGACATTCGTCTTGACTTCGACGAGGAATTACTGCC
TGAAGACAGTTTTGAGCCGGACCGCCTGGACGGCGAGTATGAAGTCGAGGCTATCCTCGATGACCGGACACCGTTGTCAACGAGCACTGACCGGGCCGTC
CGAGAGTTCAAGGTGAAGTGGGTCGGCTATGACGAGCCGACATGGGAACCAGCGTCCAATCTCTCGTGCGGTGGCCTCCTGTACGATTACCTACGCCGGA
AGCGAAGCGACCGACGTTTGCAAATGGCCCAGGTGGCCGAAGAGGAGTAATTCTGCGCCCCAACGAGGATTGAACTGCTCGCGGGGGCAATCCAGCCCGC
GATGTCAGACGAACGAGGCTACTGGAGATGATGATTGAACTGCCTGCGAGGGCTATCCAGCTCGCAGTGACAGACGAAGAAAGTTACTGGAATCTGCATG
TTACGTGTTAAGTGAAAGAGTCACGAGGGAATGGAGATATCGGAATGGAGCCAGGGACAACGGAAGACGCAAGCAAGCCTCGGTCAAACCCTCAACAGAC
GAAACAAGCGATGATGAAGCAAATGGGAGGGCGGCCGAGGCTTCGGACGCAGTGATTGCCATGGAAGTAGCACGAACAAGTGCGCTCGACTTCGCGGTTG
AGTTTGGAGTTGATGATGAAATGGGTATGCAAGCTGTCGACACCGGATACCCGCAGCAGACCGGGTGTACAGTTGTCAAAATTGGGCTGTCATGCGAAAA
CATACCCGCAACGGAGCTAGCGTAAGTACGCCCGGTCTCCCGCGAATCAAATCCGGTCTTCAACGAGCATAAGCCCGATCTTCTTGCAGAAAGACAAGAC
GAAGCCCGGCTGTCGCAGCTACGAACCAAGCCTCGTTTGAGGCAGCCACAGCGGTCGAGGGCAGAGAAGAAGCTCTGGGAACCGCGACCGAGTATTGAAT
GCGATGTGCGTTGACGCGAGAAAGGATTATGAAATGGAACGAACAACATGACGTTATTTTGGATTGGGATAGCACATGCAGCGTCGCCTAAAGCGTCACG
GACCTCGGTCGACATTGGAAAAGAACGTGAACGAAACGGTGAAGCTGGAGCGGGGCCTAACGAGGCTAAATCTCCATCACAGCCTGAGCCAACACGCCCA
GACTTGACCCGACGGCGGAAGAAGCTTCACCCGACTCCTTCGTCTCCTCATCGGGGCTTGGAGAGCGAGAACGACGAGCGTTTACGAACTCGGCCACCCA
TGGAGCGACCACCATCGAAGTCCGCAGAGAAGATTCGACCACGACCGACGACGCCACGGTTTCCCGAGTCGATCCGTTGGGGACAAACAACGGGACGTCG
TTGCAA