Description :
From Genome Similarity Track
Location :
Scaffold_85:88344- 89665
Transcript NameFunction/comments
Phyca_LT1534511456Equilibrative Nucleoside Transporter (ENT) Family

Sequence
1321 bases(100 bases per row)
cgtacaagaagaccaggtagaactgggccacgatgggatgccagaggagatctgggacgatatgatcaagaacgagcgcaacatcttcttctcgctcatg
tttcttaacggttcggtgctttgggcctactactcgtgtctgagtgcacaggacttctacacggtcgagttcgccgactctggcctcgacttctccttcc
ttacgacgctctgtacgtcgtggccaatggttatcggccaggccgttcagatgatctggggactcgacaagaagctcacgcaggagttccgtgtgcgtgt
gggctacggcatcttcatcctcatggccatcctcatcatgatcttcagtgccatcgagttctccaaccagaagacgggggctatcctcgtcctcatctgc
ttcggctgtgtcggcttcggtaacacgctgtccgagtccacgtactacacgatcgccgcgctgttcccgatccccaagttctcacaggccgtgcagatcg
gtaacggcaccgccggtatcctcaacatttcactcgcgacgttgctgcgtctcgctgtgggtggtgttcaccagacaagcagctctaccaagttggcgtt
ctacctcttcttcggcatcctcatcgtcgtccttatcgtggctctgttcgtgtaccgtcggctgacgaacctacccagtgtcaagttcctgctcgagcgt
aacgctgcttcggctaaggaggagaaccttacgaaccagcccgtgactaagacactcagtaacctgggacggatcttctccatcatttggatgccggctg
tggctcagttcctcgtcttcttcgtctcgctgtccgttttccctggattcggctgcgctgcctcccgcaacctgatgccgccgtactcggacgtgacgca
cacggtgactatgaactggtactgtgcgccgggcatcgtcggctcgtacaactacggcgacttcttcgggcgtatcctgaccggtgcggccgtgtacaag
ctgcttaacagccagtggtgcttcggtatctcgatcgtgcgcttggccttcatcccgttgctgcttatgggcgtggctggcacttctctctatgctttcg
gccacgacgacatgacggccatcgtgtacaacatcatcctcaacctcctcatcggactttccaatggtttcctatccacggtgacgatgggcgtgggccc
tcgtctgttgaacccggaggaccgtgagtctggtggtgctgtcatggtgctctgtctgttcctcggtatcgccggtggttctaccttgggcttcttcttc
agcgaccagggctggctcggc