Description :
From Genome Similarity Track
Location :
Scaffold_703:8831- 10259
Sequence
1428 bases(100 bases per row)
GTAAAGCGGCACTGGCCAAGCTATCCGCACTGGCATTCCAATTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCGCTTGACATGC
ACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTC
TGATCGCCAAATTTGAATCCCAACAAATCACCAGCCTTTTCGGATCTTGTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTT
GACGGTGAGGCCTTCCGCATAAGTGGATCCGGCCCGTACAACTTCCCATCCAGGTAGTCTCCACAGTATTGCGCTGTATGCCCCTCCTCCGCGTCGTACG
CGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGAAGCGATCCTAGTCA
GCGCCTCATCCACCTTAGCTCGAGGAGTGATGCTCGCGGCCAAGACTCCCAGGATCTCGTCTTCCCCTTTTAAACATTTCACAATCTCCAGTGTCCAAGG
CGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCTGCCGACTTGAACAGCCAGGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTT
CCCACTAGCAGGTTGTAATTCAGATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGC
TGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTC
TGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATG
TTTTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGGCGTCGTACCACTTG
GATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCGAAATCTACCTCTCTCAATTC
ATATAATACCGCGGCAAACAGGGCGTAATCCTCGATAAACCGACAGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAG
GGCAAATCTGCTAACGAAGACAGGTCCTTAGAATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGC
TCTTTACCACACTGATGGAGAGATTCCA