Description :
From Genome Similarity Track
Location :
Scaffold_716:883- 4815
Transcript NameFunction/comments
g15089.t1ETI30235.1 hypothetical protein F443_22644, partial [Phytophthora parasitica P1569
g15090.t1ETL28519.1 hypothetical protein L916_18149 [Phytophthora parasitica

Sequence
3932 bases(100 bases per row)
CGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGTTCCTTGTATTTGCCGGCGGGTTCTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGC
GCACCGTTTCGTCGTGCAGCCCGGCTGCACACGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAG
AGCCGACGCGCCTTCTTTACCTGAACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACGACCGCGTCGCCCCGGACG
CTTCGAGACCCTCTCGAATCCAATTAAATCAGGCCTTGCTGTTTCGGTTCACAGTTCCATCCAACGACTCTTGCATTGGTTGTTGTTCGCTCGGGGTGAT
CCGAGACAGCCGCATTCCGCGCTGTATCTAGTGGAGGGCTGCATGCACCACGTGGTGCATGTGCTGTGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCT
GCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCAGCTGATCATGCCGTGGCTTGCACGGCATGCCCAACACCATATCGAACTTATCGTCC
AGTTCGAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATATGAGAAGCGCACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTA
GCCTCACTTCCAATAGACTTCGAGGTATTTTCACCTCTTCGAAGTCAAGCCTTGGAAGGCTCTACAGTCGAACAAAGTTGTTCGACGCACCACAGTCCAC
TAGAGCACGAAGAGACCTCTCTCTCTTCGAGCTTACCTTCAAGATGACAAGGGTCGGGTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGG
GCAGCGATCTTCAATGCAGCGTGTCTGATGTCGACACGCTCAACCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTCTAGTTTTTTTTATTGCC
CGTGACGATACCCTGTATCGCCACGACGGCTCTTCGCCGCGTGCACAGCTGTGCACTCGCGAGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCAC
ATTCGTTGATCCACGACGCTGCTGGGGACCAGCAGCTGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATC
AGCCGCGGGGCGTTCACATGCAGTTTAGCCTGCCGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGA
AGAGATAGGTCCATCTATAAGGCCTTTCATGAACGTGCCGACCTTTGTCGCCTCGTCAATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTT
TGGGCGTAAGCATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCT
CCTCCTTGAACTCCTCGTACGTGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAA
CGCAACCTTCGACAACGGGTCGACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAG
CTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCA
GAGCAACACCGTGTTGCTCCGTCGGCGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTC
TGGCTCCGACAGGTAGGGGTAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACACGTTACTGTCCGAGGGCAGGTTCTCAGCC
CCGCGTTCGTATTCCATACGAACGTGTTAGTCGGTCGTTGGACGGACTACTAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTA
CACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTGATTTACTTAAGTTCAGTATACTTGTATCCGCAAGTATACTTAAACCTAGATAAAGGAACCGAAC
GATAGCTTTGGTGCCAAATGAGAACTGTATTGATTGTAAATGGGGTGTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCA
GAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGATGTTGCTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGAGTGGTC
ACCTGAATGTATTCCTTAGTGCATGCTGCACTAAGGTAGGAGGTGAACCAGCTGTGTAGCCCTGCTACAGCCCCAAGTCGAAACGGGTGGTGGAGAAAAA
CTCTATGAGGGACTTCCAATTGTCGTCTTGCTCCTGCCGAATGTTGACCATCACGTTGGATGGGACGCGCTCCGACGTAGCTACAGCAGAGAACTTAGGA
CACTGAGCAATATTCACGTAGCTTCTGTCGCAGTTGAGTAACGTGGTCATGTCCACATTGTATGGCGCCAACGAGTTGCGCTGAGGCTTCACCATCCTAC
CTGCTGTCCCGGAGCCTCTCTCAATATGGGTCGACGAAGATGACAGTGAGAAAAACACGCGCGCCACCAGAGGCAGCAGGCGAAAGGTGCCAATGTCTTG
CTGGCATTTCCAGAAGGTGAGCACTGGCTCAAAATCACTGAAGCTAGCCCCTTGAAGGGTGGTTGTCGTCGTCAGCCGCCGCTCAAACTCGTCGTCGATC
CGCTGCTCGTGCAAAGCCGTCGCCGTCGTTAGTGACTGTGGAAGTATCTCGCCTGCTGTGTCAACAAAAAGCGTCATGATGCCTTTGGGGAAGATGGCGG
CTGGTGGGGGAGCGACGACTTCGGGCATGCTCGGTGTTGAGTCCATGGCGACCATGATCTTTCGCATACTATCTAGGACAATGCGGCGAACCTTGGTGTA
ATGGCGCTCCACCACCTGCTGAGATGCTCCGGCCTGCAGGTTACTCAAGATGACGATCCGCTTGAGTGCGCCATCTGGGTTCTTGAAGTTACGATGTAGG
AGGAGCTGTATCTCGAACGTGTAGGAGCATTTTCTCACGACATTACGATCTGTGTATCGCCTGAAGAAGACTCGGTGAAACATTTTGTGCAGCGACGTGC
GTGTCGTGGATGCCAGGTTCGACAGCTCCTCTGCACGGAAGAATTGCTGTTCATCCTTGATTGAGCGGCAGTCCTTTAACGACTGTGTGGTGTCAAGCAG
CGAAATCTGCAGTTTGTATAGTCCCAGTAGCACATTACACTGGTTACAATTCTCTCCTTGCCCAGCTTGATTCAGAGACGAGATAGGCTCGAGCAGGGAA
AGAACCTGCACCATCTCCATTTTTTCTCGTGCCAGCGGGAACGTCACGGGCGGAACCACGCTTTCGCGGCGAGCTTTTGCAATGCGCTCGTCGTACCATT
CGACGAGCGAGCAGAGCGGAAGCAGCAACAACGAAAACGGCGTAGATCAACACTTGGACAAAGCAAATTTGATATAACAATTGGAGTGGCAACATACAAT
ATTGGGGGATTGGCGACGCACTTGCACGAGCTAAGACAGCACTTGAGAGCAGTGCGAGAGAACACAGAACATGGACACAGAGACCTAATACTCCTAGAAA
AACCTATCAGACAGAGATGGAACACAGCTCAGCGACGGTGCACTATGCGGCACTATGGGGTTTTAAACACACAGTAGATCATACTATGTCGTGGCCGAAG
AGAAGACCTCATTCCTCTCCGACCACAGGGGG