Description :
From Genome Similarity Track
Location :
Scaffold_188:883- 4674
Transcript NameFunction/comments
Physo_144447hypothetical protein
Physo_144448Os09g0296700
Physo_144449ubiquitin conjugating enzyme

Sequence
3791 bases(100 bases per row)
ATGCGGACGCGCCGACCGCGACGTCCACGAGCTGGCGCTACTGTCTCCACATTACCTACTACGGTACGGGCTTCGTGGGGTGGCAACGACAGCAGCAGGC
AGCGAAAAGCAGCTCGGGCCATGACAGTGTGCAGGAGGTGGTAGAGAAGGCTGTGACGGAGACTTTGGGGGCCTCGCAGCGAGTCAACGTCACGGGCGTC
AGCCGCACGGATGCAGGCACGCACGCACTCTATGTACGTGAGTTTTGAGAGCAAACTGGGAAATGTCGGGGTGTTTTTACTAAAGGGTGTATGCAAAATG
TGCATTCGTAGCAATATGGTTTCATTCGACTCGGCTCGGAGCTGCCGATGTCCTTGGAGGAACTGAAAGATCAAGTCAATGCCAAGTGAGTAGCAAAAAA
GAATGTCCTCGACCTTGTAGTGCTACGTTACAGTGGTAGAGTGACCGCGTGCTGTCTTGCTATGCAGACTGGGAAGTGACCGAATTGTGGTGCTTGGTGT
GACGGTGCCGACGACGGGCCCGGCGCGGATTCGATCGCGGTACAAGAAGTACATTTACTACTTGCAGCAAGGACACCGCCCGGACTTGGAGCTGGGCAAG
TACTCGTGGTTCCTCGGTAGACGCCTGGACATCCAGCGGATTCGTGATGCACTCAAGTGAGTTGAAGATGCACCGGTGGTTAATTAGTTTGCGCCTGGCA
TGAATTTTAACTGGTTTTGTGCCTTTGTAGGTATTTGGAGGGCACGCACGACTTCCGTCCATTTTCTCAGGGGCTGTTGAAGCCGAAGTTTGAGGATCTA
ACAACGTTGCGAACCATTATTTCCGCAAAAGTTGTTGTTCGACGGTGGGTCTTTTGTTTGCGCTTCCGAACATGTGCGTAAGTTACTATAACTATGCATT
ATGAATAGGAACGTGAACTTCTCGCTGGATCCGCAAGTGTGCGGTAGTGGCGAGGTCATTGACGTTGCGGATATGTACAAAGACCCTCCAAGCAATGCTA
CTGCAGAAATCCACAACTCGGACGGCACCAAGGCTGTAGCCACAGGAGACCATAAGAAACGGAAGATCGAGCAAGCCAAGGGAGGAGCACCCGTGCACTT
TGTTTGCATTGAGCTCGTTGCCAATGGCTTCCTCCGGCACATGGTACGACGGATCATTGGCACTTTGCGTCCAATTGGTGAAGGCACGCAGCCACCTTCT
CGAATGCAGCAGGTACTAGCAGGTGAAGTCCAGCCTGGTCCATCTGCCCCTACGAAAGCTCTGTGGTTGCATCGTACTTGGCTCACACAAGAAGAGTACG
ACGCGGACAGTGCTGCGGAAAAGTAGACTGGACAGTCGAGTTACAAGCAAACGGCATCGTCGAAATAGAGCACCGCTTGTAGCAACACGCACATTTTGTT
TAGCGTGTTTCACGAATATTCTATAGCTCTTCATGCGCCCCTGCAGATTGAGTGGCCTCTTCCTTGGCCGCAACGTGCTCCAAAATTCGCGTAATATGAC
CCAGAACGATTTCTCCAATGATTTCCGGCGAATACTTGGCCACCATGTCATCGCGCGCGTGTTTACCCTTCGCAACCGCTTCCTGTAATAAAGAAAAACT
ATAAGAAAAAGTCGCGGAGAATCGGCGTGGCTTGAAAGTTCACATTACCTCCGGATGCTCCTTCACGCGAATCAACAGCTCCTTGAGGTGCTTCACGGAG
GGGTCAGCCCACATGTGGCCACAGAAAGCGCCTTCAGTGATCTGCTCAAACGATCAAGTAAAAAAACATCGTAAGATGACACGGTTTAGCATCAGGAACA
ATAAATCGGAAGCATTACCTCGATAAGGCCATCAATCTGGAGTGGGTACGAGTTCTCCTCCGTCATGTACTCCGTAGTGCCACTCCAGAACGTAGCGATC
ACGGGGCGCTCCATAGCCATGGCCTCGACATGCGGCCGGCCCCATCCCTCTCCACGCGACGGGAGGACAAACGCATTAGCAGCCTTGTACAGCGATGGCA
TCGCCTCCTGAGAGATATGCGGGGGCAGCACGTGAACGTGCGGCAGCTCACTCAGCGGTTTGTCCACTGCTTCTGAAGCAAACTTCTCGATAAGACTCTG
GAAGTCCCCAGCCGACGACGACGAAGTGTGGTAACCGTTCGTAAGCAGCACAAGAACCACCTCATCCTCAACCGAGAACGCCTCAAAGTACGCAGTGAGC
AGCACCTTCCAGGCCTTGCGCTCTTCCCACTTGAAAATGGACAAGTACACGGTGGTCTTGTCCGTCATCTCGAACGCCGTCTCGCTCGCCAGATCGTACA
CTTGCTCCACCTTGTCCGGGTCGAAGAAGTCCACGTCAACGACTTCCGGTACGACCTTCACGGCTTCAGGCCTGACCCCGCCGTCAACAAACACCTTCTC
CTGGAACTTGGTAGGCACCCAGATCTCGTCCATCTTGTTCATCCTCTCGGGCCAGCCCTTGGGCACTCGGTCCGTCTCGAACATGGTTCGTCCGACCTTG
TACTGGGCCTTCTCCGGCGGACACCTGGACGTCATGTAGTGCGCGGGCTCCCAGGCGCCGGGCTCCGAGTGACAAATTGCCAGCGCGATCTTCCTGTTCT
TGAGCCGCCAGTAGAAGTCCCGCTCCTCGATCCAGTGGTGCTCCAGCTTGGAGCGCATGTCCTCGGGCAGGTCTCGGATGAAAGACGGGTTCAGCGAGTC
TCCGTGCTGCGTAATCAGCAGCTCAAAAGGGGGTTCCATTGCCTCCTCGCTCTCATCGTCTTGGCTGGCCTCTGAGTCCTCTTGACTGCCTGAATCCGAC
GAAGATACAGTTGACTCCCCCAGTGCAGCGTCCACGGCCACGACGTACGAGTGCGCTTCGCTGCAGTAGCCGCCGCCGCTGAGGAAAGGGGCGTACCAGA
GCACGGCTGGACGTCCAGACTCACTGGAGACGGAGGCATGACGCCCTGAAGCCACAGCAGGCGTCGCTAGCAGCGCACAGAGCGCGGGGAAGAGCAGCGC
CACCTTCATCTCGAGGGTAATGATACAATTCTGACAATAAGAATCGAAATTTCGCAATAGAATTTCAAGTTGAACATGATAACTTTCGCGTTAAGGATGA
TGGTATAGTTGCTGCTACCGTTACCGTTAGTTGATCTCCTGCGCTCGCGCTGTGTTTAGCTGCGTATTGCGTAGGGAATGACTGCGTTTTGTTGTTTTTG
CTGTTGGTCTATCGAGTTGTTACGTTAGGACGCGTACTGCTTGGTCCACTCCTGGGCCGTCTTCTCGAAGTCCGCCTTGTTCTCGTGCATCTGCTTGGCG
ATCTCGGGCTCCAGCGGGTTGTCCATGTCGGGCTGCTCCAGGATCTGCTTGATGGCCGTCAGGCAGTGCAGCACGTTGAGCGTCGGACCCCAGTTCTGTC
ACACAACATGAAAGTTAGGATACATCTCGGGGAGATCCAAGGGCTCCAAGCTCCATCTGCTACCCACCTCGTTGATAATATCAGCGCAGATCTCGCCAGA
CTGCGACTTGACGTTGGGGTGGTACACGCGCGTGAGGAAGCGCACCTTGGGCGCCTTGAACGGATACTCGCTGGGGAACTGCAGGTCCAAGTTGAAGACG
CCTCCGGAGTACGGCGAGTCCTCCTACAGCACCAATTACACAGTTAGCTCCTTGTTTGCTGCACCATAGTAACGTTGCTGTCTGCAACTTACGGGGCCTG
CGAGCATGGCGTTCCAGTGCATGAGGTCGTCGTCCACGGCGCTGACAGTGCACCACTCGGGCGAGTTCTTCTCAAACTCAGCGAGCTCCTA