Description :
From Genome Similarity Track
Location :
Scaffold_24:883- 4011
Transcript NameFunction/comments
g4756.t1hypothetical protein

Sequence
3128 bases(100 bases per row)
TGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAGCAGAAGAGCTGAATC
AGCTCATCTCTGAGGGCGCGGACGCCCTCAGCACGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAA
GGTCTTGCGTGAGTACAAGGATGTACTACCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACG
AAGTACTGCGTCACGCGGCAGTGGCCACTGCCGCGTGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAAT
CGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTACC
GGCACAGACTCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCGAGTACTATCTTCAGTACTCTCGATCTGAGAGACGGGTTCTATCAGATC
CTCATGCGTGAGAGCGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAG
CGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGTTATTTCGATGACGTGTTCATTCACAGCCGGGCTGTGAATGG
GAGATCGGATGTGGAGATGCATACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCTATGCGAACCTGAAGAAGTGTATCTTCGGG
GCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGAAAGAACGGCGTACGCCCTGACCCAGGAAAGGTCAGAGTGATCAATGAATGGCCTACGCCTTCAA
ACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGTAAGTACGTGAGCAACTACGCGGGCAAGATTCGCCCGCTGTCGCAGCTCTTAAA
GAAAGAGGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTCGAAGCAGTCAAGCAGGGCTTGACTGAGGCGCCGATTTTGGCGGTGGCCGACCAA
GATCGCCCATTCCACGTGGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCACTGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACC
AATCGCGTCAGCTGAAGCCAGCTGAGCGTAATTACCCGGTACATGACAAGGAACTCCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACT
TGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAAAATGGCACGGTGGCTGTCAT
TCTTTGCTGAATACAACTTCCAGGTTGAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCACTTTCGCGTCGACCAGATTATGCGGTGCAAGAGGC
CGACGCCAACGCAGTTGGCGTCGTCAGGATGACTACACCCTCGTCGTCCTTGCTGGACGAAGTGAAAGCCGCATACGCACATGATGCGGATGCGAAGCAA
GCAATTGGTGGAGTATTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCTGTGTACACCGTTATCGTGTACACAATGGT
CTGCTGCTTTACAGCGCAGTCGACGACAATGCAGATCGCATTGTCGTGCCGGATGATCATGAGCTGAAGCTCAAGATCACGTACGAGTACCACGATGCCC
CGACATCGGGACACCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTATTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGC
TTGCGAGGTATGCCATCGCGTGAAGCCTGCGCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACCCCGTCGGAGTGCTGGCAGTCCATTTCAATGGAC
TTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGGCTGGTATTGTGGTCTTGGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGCAGTACCAGCCG
AGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATTGTGTCGGATCGGGATCCGCGCTTCAC
AGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACACAGTTATCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCAAC
CGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCAACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATG
TCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGATA
TCCGGTTAATTCAAAACAACCGGATAAGCATGCTGATACAAGCAATGTATCAGCTGTAACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACAAG
ACAGTATCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCGCAGGCTGGGCCTGCTGCGAACAAGGAACACGAACTGAACCAGGGGTTCA
GCTCGGATGCAATGGACTTTGTCCAGCGTCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCGA
TAACTCCGGCAGGGGAAACACAAATGAATTTAAAATTGGTTCATTAGTTCTGTTAGCTACTCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGCA
AGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGGCGAAGCATGACAACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAA
CGTTTTACGTTGGGCGACTGAAGCCGTA