Description :
From Genome Similarity Track
Location :
Scaffold_411:883- 2350
Transcript NameFunction/comments
Phyta_totarag8044hypothetical protein PHYSODRAFT_325587

Sequence
1467 bases(100 bases per row)
TTCCTCACGCTGGAGGACCTCAAGATGGCCTTcaacgtcttctgctgcgtctacGGTGTTGGAACGCTTGGTATGCCCGGCAACTTCTCGCGTGCCGGAC
CCGTTCTCGCTGTCATCGCCATGCTCTTCATGGCCTTCGCCAACGTCTATGCGTCGGTGGCCATCTGCCGCGTCATGCTGTTGGCGCCCAAGTCCGTCAA
GACCTACGGCGACCTCGGTCATTGGGCCGCGGGCAAGTGGGGCCACTGGTTCGCAGTGGTGGCTCAGATGGCGTCGTGTCTGCTGGTGCCCTGCGTGTTC
CTCGTGCTGGGCggctcgctgctcgacggACTCTTCCCGGACGCTTTCAGTCAATCTGTCTGGATCATCTTGATGGCCCTCATGTGTCTGCCGGTTTGCC
TCATCCCGACTCTTAAGGAAGGAGCGGGGGCTGCCTTTGCTGGATGTGCGGGCACCGTCATTGCCGACATCATCGGTGTGGCGGTTGTTCTGTACGGCAT
GCGTGGCCACCCGTCCGTGCCGTCACCCGACCTCAAGTTCGAGCAGGTCGCCGGTGTGTTCGGTAACTTGTCGCTCGCGTACGGAGCCGGCGTGGTTATC
CCGGCCCTGCAGCGTCAACACAGTGACCCGAAGCGTATGCCGCGTgtggtcttcttcaccattACGTTGATCTCGTGTCTGTTCCTGGTTCTGGCCAGCA
CTGCGTACTCGGCTGTGGGCTGTCAGATCTCTGGGAACTTGCTGTTCACTATCTACCCTGACGCCGACACGGGCATGACCACACTAGGCTTCAAGTCGGA
CTGGGGTGCTGTTGTTTTGGCCTACCTCTTCATGCAGCTCCACATCACTATCGCCTTCTCTGTTCTGTTGAACCCGGTGTTCTACCTGTCGGAGCGTCTT
GCACTGGGCAtgcacaagaagaaagcgagcGACATTGAGAGTGGCCTCACGTACGCTGACATGGGAACACCCACAAAGGAATCGGTTGCTAACCCCTCCG
TCAATGTCTCGGAGCGTCGATCGGGGATGTCGTACATCTCcgtcgctgacgctgagAACCCGCACTACGGCGATGCTGAGGCGGAAGCTGCGGAGTACCG
CGGTGGCGCCAACATGATCAAGTACGTGCTCGTACGCTTTGCGATCatcgtgttgctggtgatCCTCTCCATCGTGCTGAAGGACCACTTCTCAGACCTG
TCGGACTTCGTTGGCGCATCCTGCATTTCGCTCAACAGCATCATCCTGCCGATCGTGTtcctgctgaagaagtgctGGAATGTTATCCCGATGTATGAGA
AGGTGCCTGCGCTgatcgtggtggtcgtgtgCACCTTCTTGGGTTGCTACGTGACCTACACGTCAGGCAAGACTCTTTTCACTCCGACGGACTCGGATGT
ATCGTTCCCGTACTGCGACTCGGAGTACGAGAACATGGTGTACTACAACTACACCGCCGTGCACGGA