Description :
From Genome Similarity Track
Location :
Scaffold_324:8828- 10848
Sequence
2020 bases(100 bases per row)
GATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGC
GACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTAGAGCCCACTGATCCTCCACGGGTGGTTGTACCCAACGACGA
GGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGG
TGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCGGCTCCACTACAGAGCC
TGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTG
TCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGTGAACAAACCGCCAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGT
CTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGCTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTG
CGGACCATCCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGAC
GCAGCTTCCAGTCATTGCGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCTCAGAGTGCCT
CTCACTCTTCGAGGAGACACCGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGC
GGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATTAGCAAAAGGAGTACTCAGA
CAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGCACTTAGTGTTGCTAGACACGAGGGACCCTACCTCTTGACACTGTAAGCTCTGTCGGCAG
CAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCG
ACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCAC
AGTCATTGACGAGGTCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGCACC
CCCGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCAAACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCT
CGATCCGTCGGATCATGCAAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTC
CAGGCGGCCCGCAAGCCGAGCGAACTCGCCCTGATTCCCGGCCTGGGCGGCAGAATTACCGCCAGTCTCAAGGCCAAGTGCAATCTCAAGCACGAGGACA
CGTTGAAGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCAGGAGGCGCCGAGTACTCGTACTCGT
ACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTTCACGTGAAGCGGATCCTCCAGGAGCAACGGCGTCGCAGTAAGCGACAGCTCC
TCCTGAAGTGGAGGGGTTAT