Description :
From Genome Similarity Track
Location :
Scaffold_263:8828- 10038
Transcript NameFunction/comments
Phyta_totarag6375hypothetical protein PHYSODRAFT_486841

Sequence
1210 bases(100 bases per row)
CTCGAAGTACGGGATCTCGCCGTGCGGCGTCACACGCACAGCGTGACGGTTTCCTGGCAGGTAGTCGTATGTGGCGTAGTGAACCGTGGCGCGGTTGTCC
CAGATCGCTACCGCATCCTTGGTCCAGTGGTAGCGCACCTGGAACTCTTGGCCCTGCGCGATGTGCTGAAGCAGGAAGCGCAAGATGGCATCTGGAAGAG
AATCGTACAGGAATGTCAGTACGGCATTCCAACACGACAAAACACCGTACAACGTACCAGACTCAGGTGCTGACAGGTTGTTGACACGAGTAGTGAACTG
AGCGTTCACGTACAGCGCCTTACGTCCCGTCACCGGGTGGGTACGAACAACCGGGTGCTCAAACTCCACAATGGGGCGGCGGAGGGTCTGGCCGTTAGCG
ATTGCACTCTCGGATTGACGCTGCATAGTTTAAACGAGCAGCACTGAGTGTTTTTACTCGGAAGATGGATAGACATGTAGCATCTCGTACCTTACTGCTA
TGAATGGCCGTTAGACCCTCCACAAACTTCTTGAATTCCGGAGTGAGGCGGTCATACGCCTCGTAGGCGGAAGCCCACAAGGTGTCTCCTCCCGTAAGTG
GGGTAGTTATGACCTTGAAGCTCGTGTACGACGGCGGCTACCAACAACACAAACCATAACCGAATGTCAGCACCCCAGCACATTCACCCTCTCACAAATT
TCCTCACCTGACGCTCGTAAGACACGTCGCTGTGCCACAGATTCACAGGCTCTAGTGCCTGGGACTTGATGCGTCTCTCGCTAACCTCAAGCGAGTTCTC
CACCACATGCACCTGGGGAATGCCCTTCGCGTGAGCAACAGTCTGGTGCACGTGCAGAGGACCGTAGTAGCGGCCCAGATCCAACTGTTCCTCGATTGAG
AGTTTCTGGTCGCGGAAGAACACCACGCCGCgctgcgccaccagcagcgccaactcaTCCTTCTGCGTGTCCGTCAGCTCGTGTAGCTGCAGACCCGAGA
TCTCCGTGCCGATTTTCGGCTCCAGGTGCGTCACCGTCGCGGCGGCCAGCAGGTTCTTGAAGGTCGGGTCAGCCTTGAGCGCACGATCCTCGTGCGGCAG
CACAGGGATCGGGTCGTAGGTCTTGGTGGGGAACTCGCCGAGCAGTTCCGGGTGGGTGAAGAGAGCATGCTCGATTTCGAGGTTGAGAGCGTTCTTTATG
GGGGCGGGAG