Description :
From Genome Similarity Track
Location :
contig_21:88266- 91273
Transcript NameFunction/comments
g3839.t1hypothetical protein

Sequence
3007 bases(100 bases per row)
TCCATTCTCGGCTGCCGAGTTCATGACATCCGTTGACCACTCGATGTTTGGCTGATCGTGCAGCCATTGCAGCATCTCTAGGTTGCCATTGCGAGCTACC
ATACTCGTAGTGTGGGCTTCGAAGGTCAACTGAGGGTGCTTGTCACGAATCCACTTGACGACCTCAAAGTGCCCCATAGTAGCTGCACCCGACAGCGCAT
ACTGTGACAACGTTGGAGCATCATTTTTACCTTCTGCCTGCATCTCCACAGCAAGCGAATCGAGGAACTCCAGTACGTGCATATGTCCGTTGGTGGCTGC
TCTGTCCATGGCAGTGTTGTTGAACCAACTCACGCGAGATGGCTCGATCTCCGGGAAAAGAGGCGCCATTTCCCCAAACTTTTCAATGAGCCACGTGACC
ACATGCAGATGTCCCTTTGAAGCAGCGTTGGTCACCATTTCAGATGGCTTGCAAACAATGCCAACTTCAGAGAGGTACTGCACGATCTCCAAGTGGCCGC
CACGAATTGCACAATCCATTGCGAAGTGTGGATACTGCACAAGTTTACGGTCCAGTAGCGACCGCACTATGCCAAGATGGCCTTCCCCACAAGCCGCTTG
CAGGGCCTCTCTAGCTCCTTTCGTGATCCATTTCCCCACGAGCCACTCGACCAAGTCCAATCGACCGTTCTTGGCTGCTCCCTCGAGTGCGCGATCTGAT
CCATCATTGTATCCTTGTTCGAAGATCCACTGCAGAATGTCCATATGACCTCCAGCTGCAGCGTCATTCATTGTCGGAGGAGGCAGGTGAAGCTCCGGTC
TGTAAACATCGTCCAGAAGCCACTGAACCAACGTCAAATCACCCATTGTGACCGCAAACTCCATCACTCTGCTCAAGTCTCTTTCAGCATCAGGAATGTT
CTCATACAACCATCTTGCAACTAGTCCATGTCCTCCTTCAATTGCATTCTTCACATCTTCTTCTCCCCAAACGATGATATTCCGCTTCTCTTCTTGGTTG
TCATAGTGCAGCAAATGTTGCAAAACCTCCAAGTGTCCGCATCGCGCGGCTGCTTCCACAACTTCCACGCCCGCCGTACACCCGAGAAATGATCCAAAAG
CCAGCGAATGACCTCTAAATCCCCTCGTTCTGCCGCGGTCCGCAGCGATTCCGTGAATTGGTAGCGATTGTAGTGAACGTCCGATCGCAAGTACCAGAAC
AACGACCAACTCGAGTGGTGTCTGCCGCAGGGTCACTGCTCTCCCAAATACGATCCAGGAGTCGGACGGACCCAAACTCACATGCCCGATCCAACGAAAT
CATGCCCGACCGTCCAAATACGACGAGATTAGTGTACCACATGGCCAAAGCTGCCACATCAGGACGCGATTTCAACGCGAGCTGCACCGCCGCCAGCGCA
GTTGTCACCATTGCTTCGAGTCAAACGGGGGGATATTGTAAATGTAGCTGGGTAGAGATTCCTCCCCGCAGGTGATGGTCCCTCATTCCAGAGACCTTCC
AGCTGGCACACTGACCACTTCCAATTTTGGCCTTACAGGAATTTGCGTCAATCTGCAACGAGTAAACCCCAATATTCGATGTAAATCGACTAAATACGAC
ATACAAATTGAATGTTTAATCGTCTATATATTTGATATCCCTGTTAAGTCAATCAGTTGCGGGCGTTGCAGACTAGCGGAGGTCTTTGACCTTTAAGGCG
TTTTTCAGGAATGTGTTGCCCCTGCAGTAACACGAGGGCTTGTGCATTATGCTTGATTGTAGACGAATTGTCCGCAAGAAGAACATACTGTGCATAGGTT
GAAGGCTTGAGCATTATCGTTGCATTCTAAGGTTGAGTCTCGTTTCATCGATCAAGTGATCCACATTGGGTAGTGCTCTTCCAGCCATGCAAGGAGGTAT
TGTCCTTGTGCGCTGAATTTCGTTCCCAGAGTGATCCCCTCGGTGCGCTGAGCGCGCAGAAAGAGAAGCACCTCGAAGCCCCGCAGTAAAATCTATGGGT
TCATCCGTACACCCTCGGTGCGGTTGTAGTGCAGCCAGCGAACAACGCCTAGATGGCCGAAATGCGCGGCATGGTTCATCGCATCCGTCGTACAGCCCTC
CACGCGGTTTTCGTGAAGCCATTCATCGTCCAATCAACATCCGTGAGTTCATATAGCCATTTCATTCCAAGCGGCCACTGAGAGCTGCCATGTTCGTAGT
GTATTTCAAATTCACTGGATAGTGGACATAAAGCCACTTGGCGACTTCAAAGCGACCCAAGGATGCTGCGGTTGAGAACACCTAGTCTGAGCAGATTGGA
TCCTCTGCCTTCGCCGACTCCACGAGCGAATGCAGAAACTCCAGCACGTGAAGATGATCCATACCGGCCGCTTTGTCCATCGCAGTTTGGCTTGAATAGC
CGTCATTATCTTCCGATCGATAGTATGGTGGGAAGACCGAGTAGGGCTCATCTCGATACTTCTCGCACAGCCATTTAACAATATCGAGATGGCCATGCGT
GGCAGCTTCGTTCATCATGTCGGACGCACCACCGACCATTTGCCTCTCGTTCAAGTACTTGACGATATCCAAATGACCTTTACAAATAGTGCTTTTCATC
GAGTATAGAGCATATCGCCCCAATCTGCGGTCTAAAAGCCACTGCACCATATCCATCCGGCCATTCTTCGCTGCTAGTTCGAGCGCATGGTCCGATCCGC
CGTCATGTCTTGCTCAAAGATCCATTGCAGGATCTCCTTGTGATCTCCAGCAGCTGCATCGTTCATGGCTGGTGGCGGCAACTGTAGCTCCGGTCTATAG
ACAACATCCAACAGTCAGTGGACCGTCGCCATGTCGACTTTGCGAACTGCAAACTTAATCGCCCGACTAAAATCCCGGTCTGCCTCATGCGTATTCTCGA
GCAACCAACTGCTTCAATCGCATTGGTAACATCCTCCGACCCCACGAAATCACATTTTCTTCTTGGTCTTGATCACTTCCACGACGTTCAGACTCCAAAA
AAGTACT