Description :
From Genome Similarity Track
Location :
contig_60:88266- 89626
Transcript NameFunction/comments
g10677.t1hypothetical protein

Sequence
1360 bases(100 bases per row)
GGGTGTTGACGACCTGGTGCTGCTCCCGTCCGTGAACGAGACGTCCATCCTCGAGAACCTCAAGATGCGCCACGCCGCAGACGTCATCTACTCGTCCATC
GGGCACGTGCTGGTGGTCGTGAACCCGTATAAATGGCTGGACATCTACGGGGAGGACAGCATGCGCGCCTACATGCACAAGGCGCGCATCGACGTGCCGC
CGCACGTGTTCGCCACGGCTGAGGAGACATACCGCACGATGCTCAGCGAGGAGGACAACCAGTGCGTCATCATCAGCGGCGAGAGCGGCGCCGGTAAGAC
TGAAGCCTCCAAGCAGATCCAGAACTACATCGCGGGCGTCAGCGGCAGCGGCGCAGGCGTCGACAAGGTGAAGCGCACCTTCCTGGAGAGCAACCCGCTG
CTCGAGGCCTTTGGCAACGCCAAGACGCTGCGCAACAACAACTCGAGCCGCTTCGGGAAGTACTTCGAGCTGCTCTTCGACTCGGCTGGACGACCGCAGG
GTGGCAAAGTCACCAACTACCTGCTGGAGAAGTCGCGCGTTGTCAAGCCGGGCAAAGGAGAGCGGAACTTTCACATCTTCTACCAGGTGCTAGCCGGACT
GCCCTCTGCTGCCAAACAGAAGCTGCACTTGGCTCGGGGGGGTCCAGAGAGCTACCAGTACTTGAAGGCTAGTGGATGCTACGATGTCGACGACGTGAAC
GACGCGCAGGAATTTGACGAGACCATGGCAGCCATGCAGCACGTAGGGATCAAGAGAAAACAGATTGAACTCGTGATACAGACGCTGGCGGCCGTGCTGC
ATATTGGCAACGTACACTTCCAGCCAGAGACCGTGGGGGATGCGGAAGGATCGTCCGTGCGCGACCGCGAGAGTCTGCAGATTGCGTGTGACCTACTGGG
ACTGGACGCTGCCCGTCTGGAACACGCTCTGTGTTACAAGCTGTTGCAGACGATGGCGCCTGGAGGCAAAGTCGAGTCATACGAGGTGCCGCAGAACACG
AGTCAGGCGAAGTCTCAGCGCGACTCCATCGCCAAGGCTGTTTATGACCGACTGTTTGATTTCTTGGTGGAGCGTGTGAACCACGCGCTGGACATTGAAA
AGAAGGCGGAGAAGCATGGCGAGATCCTGGAGATCGACGATATGACCACGATTGGTATCCTGGATATCTATGGTTTTGAAATCTTTGACAAGAACGGGTT
CGAGCAGTTCTGCATCAATTACGTCAACGAAAAGCTGCAGCAGATTTTCATCGAGCTCACGCTGAAGAGTGAGCAGGAGGAATACGCTCGCGAAGGTATC
GCTTGGGCCCCGATCCCGTTCTTCAACAACAAGGTCGTGTGCGATTTGATCGAGGCGAGG