Description :
From Genome Similarity Track
Location :
contig_79:88257- 94392
Transcript NameFunction/comments
g10212.t1hypothetical protein

Sequence
6135 bases(100 bases per row)
CCATATGCATCGGGCTGACGCCTTTGAGCTATGCGTGCCGACAGACTGCATACTTGCATGGATACGTGCTGGTATGGATTGGAGACCAAGACTCGCGGTA
GATTTTGGTAGGAGAAGTCTTGGTGGCAGCACTGTGTGTGGGTTGCCACTCGGCACCTTCCTGACTAAACCGAATGAACCACATATTACCCCCCCCCCCC
CCCCCCACACACACACACGGGGACTGTATGCTTGATCGAAAGGCGTTAATATGTACATGTATTTGTGCCAAAACGCCCTCCGTTTTAAGGTCCTACGTAG
GAGGAGGGGTCTTACGAAAGCTCGTCCTGGTGGTAGCCACTAAAAATTGCCTTAACCCTCATTTGAAAAGCAGGACTGTTCATTACGTGCACACGCGCTC
CAACGGCTTGTGTGTCGTGGGTGTGGCGGCCTCCCACCCGCTCAGTGGTGAAATATGACCTAAAACAAATTGAAATTTAAGAATGCAGACTGGGTTACTG
GCTTGTACACTCTTGCTTAGCCCGACAGAAGCCAAACTGTCGTCAACATTTCCTGTCGTCTTTAAAAGCATGCACGAACGGCGAAAACTTCGGGCGGAAA
CTCCTGGTACCTCAGTCACAACAGTAGTTTCAATGTTGTAAGTACTGTAAAACCATGCCGCTCCAGCGGATATCGGTTGGGTAGCCCATAGACGCTTGGA
TAATGCTAGGGGAGACCTTACGTAGGACGAAATGGCCGGTGGATTGTGGCCAATCGGTTCTTAGTTTGTAAAAAGGTAGCTCAAATCGGAAGTCCTTCGT
AAGACTTGCTTTACCTACATTCATTGGATAATACTCATGAAACTACTGTGATTTGATTGGGTGAATATGTATTTTGTCTTGCCTCCTGTCATTAAATCTG
CGGTGGCAACTTGGCAAATCCAACCTATACACCTAACCCCTCTTGCTTAGGACCTACCTTTTGGGGTCAGATTGGACAAAAGTCGAGAAAGGCACAATAG
ATTCATCAAACTCACACACGAAAGCAATATAATAATAACTAGTATGGCAGCAAGCTGCCAGCATCCTCACGTAGGTACGCTCCGGTTGCTAAGGGGGGCG
TTGCTGGTAGAAGTATGCAATATTGTAGTATTCAGCACCCCCCCTAACCCTTCTAACCCGAGCTCTTCTTCTGTATCCTACAGAATAAGCAATCATCTTC
ATTAAAGTATACTTCAAAACCTGCGAAAAGTATGCTGTTGTAAGCACTTTCGCTCTCAATAATCAAAACTCGGCCACATTTGGCACAAATATGCACCATA
AATGGTCATAGCATTTACAATGTATCCAGCATCTGCGACGATAGCGATTTTCTATTGGCCCCTGGAGGATAGAGCACGGTCATAACCCGCCTTCCAGCAA
TACCTGGCCTTTTCGTTATGACCGGCGGTCTTGCTCAGCCAACCACCCATCCTTGGCGCCAACAAGTCGCCCGCCCACCCCAGGGCGCGCGCAGAGGAAG
AATTTGCCCAGTTTCTAACTAACGAATTAGTGAGGAGGAACAGGGCAATTTCTCCTCTGCGCGCGATCAAGAACGACAAGGTAAGTGTAACCGCGTAGAT
GCGGCCCTTCACTAAGCTTACTCCTCCTCTTCGGTCTCTCTCTTTCGCTTGCGGAACCTTATCTTCTTTTTCAAGCTAGGTGGAATGTTCTTACCGTCGC
CCCACGTGTCATGCCATATCTGCGAGCACGTGAGCGTGTTGCCGCTCTCGGCGCGCCGCACGTGGCGGCAGAGAGGCACGCGCCCTCCAAATGCATCAGT
GCACTGCGGACAGTAGAAGCTCGTTTCGAATGACTTGGCCTTGCTATCGGTATACGCTGAGCAAACCTTACACAGGTACTGCCTGCGTTTATGGTGCTTG
CTGGAGGGGTAGAAATTGTCCGTGTTTACTAATGTGTGCTGCTAGCGAGGTATCGGCACCGACACCAAGTCTTCAGCGTTGGGATGTGTCTCGAAGTGGA
TTGTCCGCAGCGCCAGCAACTGGGTGTGCAAGCGGCGCAAGTACTCAGCATGGGTAGGTGTCTTTTCTCCTTTCTTCTTGACAGTTGACACGAGGCGATC
TTGAGTTTCTCGTTCGCAGCTGCGCCGTCCGGTCTGTACCCATCAAAATCAAGTGGGAGAGAAGATGATCCGGGATACAGCCACGTGCGTCACCCGAGTG
ACTGGCTTTCTAGAGACTGCAGCCAAGGCCGAGCAACCTGGACCCGTACAGGCCCCTGATGAGTACGTACATCCTGAATGAACCACCCAAGCCGAGCCTG
GAACGACTGTGTAGCGATGAACCTGGAAGGAGAGCCGAGTGATGAAGGCACAAGATGCAGAAGCCTATACCTCCGAAGGCGTGAAGGAAAGCGAGATCCG
AGTTGGCGACGGACATCCCGAAGCGACGAGGACATCCCGAATGATCAAGTGACTTTCCGAATGAATCGACATCCCGGATGAAGTTGAAGCTGCGTGACCC
TCAGCCAATCAGCGAGTGACACGGCGTCCGACCAGCTGGCCAGGGGGCCAGTTTCAAGGTGTGCCCGGAGAAACGCAATGCCGGTCCCACCGTCGGGATG
GGCCGTGCTGCAGATCCCCATACAAACCGCAAGTGAGTCCAAGGGACCCCAAAGATATCAGCGTCGACATCTGATGTGTGCTCCGCTCCAGAGCCCGACG
TGACGTTCGACGTGCAACCCACCATACTAAGACCAAGTCAACCTGAATGCGAGTGCGCGGACACGACGAAGAAGACCGCCAAGAATCCAGTAGACCAAGT
CAGACAGAAGAAGAAGATAGTGATAAGAAGAAAACAGAGTTTGTTTTGCGTTGGAAGTGAGAAGTGGTGCCTTGTCGGCCCCCTTGCTTTGAGCGTACTG
CGTTGAGGAAGACTGCTGCGACCTATAGCGACTACTACGAGGCTGCGGCCCGGGAGCGCTGGCGTATCGGACGACCAAGACCGCACGAAGATCGAGGAAC
CCGTGCGAAAACTCTCACCTAAGTCTAAGTCCCATTTAGGTGGGGACCAGGAACTCGTATCCCTGGATTGATCCGCCTATTTCATTTGTCAGTTGACTGT
GGTTGCTTTAGAGTGACTGCTTTCATTTCATATTCACCTACGATTCGGGAGGTTATTAGCAATCCCCCCTGGATTTTGATAGTAGATTGCTGTGTGGTTC
GAAGGAACTTGTATATTTCTCCCATCCGGGAGTGGTGCGCGGAGGCATCCCGAATTTACCTGTATTCGGGACTGTAACTCATTCGGACAGGCTGTATATT
GTGAGTGTATAACAAACTCTGTTGTTGTTTCTGTATTGCTTTTGGTTATATTGGAGAAGGTCTTTGTTCGTGACCCCACTCCCAGCCAAGACACTCCGGA
CTGTTAGAGTCTGGTAGTCTCTCTACATATCTACGTTTCCTAATCGAAGAACATCCCAAACGTCAAAGCCCGGTCCGTCGAAGATAAACGACACCGATAG
AGATTACTTCAAGGTCACACGCCAAATCTCGGGGCAGACACTAGTTGTCTGCATTCGGGATTCTGACCCCGGCATCCGGACGCTCCCTCCTAGAGGAGGG
TACTACCCGAAGCGTTCGGGTCGTCTGAGTTCTCGAAGCTCGTTCGTCTGCCGGCACGACTGTACACCCTGGACGATAAAGGCGTTCACCCGCCTCGCCT
CACAGTGATGCAATGAACGATGTATCCATTGACAACAGCCATGTCTACGATGCACAGGAATAACTGCTTGTAGTACTTCCGCAGCGAAATACACCTTTGG
ATGCTGTAGCGCTAGAGGCGGAGCTGGTCGTGAACTATCGCCGCCCATATCGAGGCCGTAGTCCCCGACCAGCTGTGGGCATGGCACCGTGCTGCGTGTT
CCATCCTTCTCCGTGCGCAGAACGCTGGTGAGATGTGTGCTACAACCAGTTGCAAGCATGTTCACAGGCTTTGGACCCATCCAGCTTAGTGCAACAAGCT
GAGGATGATCGCGCGCTTGTGCGATACGATACGTTCCTCGTGGCATTCGTTTCGGTCGTTTTTTCTGCGTGAAGTGGATCGGACACCAGCCCAAGCGATC
AACCCGTGTGGTGTCAACGTGGTACAGATCCATTTCTAGGAGCTTCAAGCTCAGCGACACCGTGGAGTAAAATCTATCGGTTACAATCAGACGCTTCATC
GGCTGGTTGATCAACGCCTTCGAGATGTTCGGCACGACGGCCTTCGGTCCTAGCCCCAATGTATCACTAGGTGCTATCTTCGTCTTCTTTTTGTGTTTAT
CCGCCCCACAGTAGATTTCAACTCTAAGTCGTGCATATACATAATACCATTAGTACCGATTAGGTTTTTTGTATGTTCCAGAGTAACAAAGTTTACCTCG
AGCAATAAGCGCCTCAGCACAACACGTCAGGTAGAACTTGGTGCCATACTTGCTAGACATGTCCGGCATGAAAACGCGCATCGGGTTGAACTTGCTGCGG
TTCGGCATCATGCCTTCATCAAAAGAGATTCCAAGTCGATATCCACGGCGACATGTTTTTTCAACTGCTTGCAAAAGCGGCCGAACCTTCCACGCCTTGT
CAGTCTGCGCACCACCGTCTCCATTGTTGTTGAAGTGAAGAAATTTCATGATGACCTCGAAGCGATCGCGCTTCATGAAGCGTGAGAATGTTCCACGTGG
TATAGCCCCATCCTCTTCGGTACACCAGTGATTGGAGAGGCCGTCTCGAATCGGAGCTATTGCTCTAGCAAAGAGCAAAGCTATAACATGCACGATCTCA
TGAGCCTGAATAGGCTTGAACTTGTTCAGGCTTTCTTCAATATCCTCCAAGTTGGGCACACTCACGCGAGGATCCTTGACCTAGTTTGTCTCGCCGAGAA
GTAGCAATGGCGCTGATATTCTGCGTTCGGTAGCGGTTCGTCTCCTTGGTGATGCGTATCCATAGCTCCTTTGGTAAGAAGTAGAAAAACATACCCAACG
GAGAGTCTGCGTACGCGACAGCCGATCTTGTGGGGCCACATTGGCCGTCGTAATAGTCCGTTGCAGCATCAACTCGGAGATTGTCTTCATCGTCACAAAT
ACATACCATCCAGAATTAGACCAATTGCAATGCAGGTTATTCTGTACCATCCGTCTTTCCGATTTGATGTTCGTCATACGTTGTCCGCCCCGACTCAGCA
ATGTCTCGGAGATCATCATCCGTCCAGTCAAAAAGCCCGATTTCGGGATCATCATCATTCAATGGCACATCCGCTAAGTCTTCTACCCCTTCTACGAGTG
CAGGTGCGGTCACATTGTCGGCCATGACGTCTTCGTCGTCCGCATCTGACTCTGAATCACTCAAATCTCCAGTAATCGTTACGTTCACGTCGTCATCGGC
TGTTGGGCCGAGCAATCGTTCCTTTCGCAGACCCTCCATGAAGTTCTCGCCATCAAACACAGCCAAATCAACGCGGTCTGGTTCGGCTCGTCGCTCTCGC
TTTTTGCTTCTTCAGCATCTGTCACGCTTTCCCTTGATTGATATTCCGGATAGTCTGGAATAGCGTCATCCGTAATACCATCTTGCTCTGTATCATCCGT
TGTAGGCGCTTTGCGTAGTCGTTGCAACTGCCATCACTGTCGCTTCGACCACCTCCGCTGATCCTTGGACACTTGTAGTAGCACGACCACGAACAACAGT
CGACCTGGTCCCCTCAACCACTACTGGTATCGAATAAGCTGAGTTCGACGTTGTGGGAGCCGAGGCTTGATCGTGAGGCGGCAGCTGACCTATGGATGCG
TACGACGCTTGCTTACCAACAGGAGCTCGGGCAGACGTATTCAAGGTAGGATGATATGGCGTGGGTAGTCCGAGGCGCCCGGATCGACGGCCAAAATCCA
TCAGCTCAGCTTCACCCAGGAAATTAATCGTTAGGTCATGATCAATATATATGAGGCAACATGCCCACCCACCTTCAAAGAAGTCTGTTCCGCGTCTTGA
TTCATCCAAGCGACCATGATTCGTGGCTTCACGTAGCGATGGTCCTTGGCCATGCTCGTAGGCTTGCGGGGCTTCAATCCTTCCTTGCATAGCTCGCGCC
ATAGCTGCTTGAACGTCTTCTCTCGGGGCCGTTCA