Description :
From Genome Similarity Track
Location :
scaffold_609:8823- 19412
Transcript NameFunction/comments
Pl_103471conserved hypothetical protein
Pl_103472conserved hypothetical protein
Pl_103473conserved hypothetical protein
Pl_103474conserved hypothetical protein

Sequence
10589 bases(100 bases per row)
CAGCAGCAGCAAACCGCATTGCGCGAGATATCGACCAGCGCAACGGCTTGCAGCTTTTAAACTGCAACAAGTCGGAATTCCACTGCATTGGTGGTCGCGT
ACATCATTGCAGTTCACCTCCTTCAGAACTTGGAAACGTTGAACATGTCGACGCTAAAACGCAACAAATCAAAGGTCGAAGCGGTCGAAGTTCGAGGAGG
TACACGTTGAACACAAATCTATCGAGATCATGAGGAGAAGCATGGTCGACCAGCTGACAGAGCACTCACCCTTGCTGTCATGGCCGAAATCGTCGCTGCG
TATTGCTTGGCTCTTGTCCCACAGTTGCAAGTGTCAGCAATGCAGATGGGAACCACGTTGAATCAAGAGATGTGGCAACAAGGAAGCCTCACTCTCGACT
TGGCGAGGTAGCGAACAAAGGCGTCGGATACGTTGCCATCGCTCAGGAAAACGCGGTGATCGATCACCACAAAGAGACGTACTACCGATGCCTATCACCA
TGAGTCGACAGACCTCCGCCTCGGAGTCGAATTCCTCTGGCCGGTACGTTCGAAACTGCATTCGCGTCCGACGTAGCATCGGTAGACTCCACTACGTGAC
TAGACCCAATTCATTGATATTCTATGCGTTCTCCTCATTGTAGCGATCTCAGCGACAATTTGCACGACAACGGTGGCCATTTCCCACTACCCGACGACTA
TTTCCCGGAGATCCACCTCACGTCCAGGGAGATCAAAAACTACGAGTCACAAATGGAAGAGATTGTCAAGAACGCGTTGGCTGAGTACGAGCTACACGAA
GCCAAAGGGATGTACCCCGTATACCGTGCTCCGTGGAGTCTAGTGAGCAAGGTAGAAGGTCTCACAACTATCAAGAAGGAGACACCTGATAGCCCCACGG
CCAGCCAAGCTCGCATCTTCGGCCGCATTAATGGAAACTACCGCCATTTTATTGACTTCTTTTATGCCGAGACGTCAGCCGAACTATTCGCTTGGAATCA
GTTCATGTTCGGGTACGCTACGGACGCGGCTGTACTCAAGAACATCCACACAGTAGCGTCCAAGAAGAAATGTCTGTATATGGGCGTCAAGTGGACGTGC
CTGAACCCGTCACCGCTCGTTAAAAAGCGTGACAACTGCTACATGGAGTACATGATCTACACGAAGGATCTACGTGGTCGAGATGTTGGAGTGCGAGTCA
CATTTCCGCTCGACATTCCAGAGTGTCCTGAGCTGCCTAAAAAGCTTAGGACCAAACGAATTCGACTTAACACGGTTTGGATTACGCGACCTGGTGACAA
CGAGCCCAATGTTACCGAGTTCTTCATGCTGTCCCAGAACAACTTCAACGGACTGGCGGTCACGACCAACTACTACAAACGCATGATGAACATTCTTATG
AACATGGCGGTCTTCGTGGACTCGCGACGCATTTTGATGCAAGGAGTTGTAACTCGAAAGAGCTGGGCAAAAGCGGGATCGCGCAAGAGCTGCAGCGTTT
GCTCGCGTAAATTCGGGCCGACTCGCCGTCGCCATCACTGCAGACTGTGCGGAAACCTCATTTGCCGGCGTTGCGCGATTGTGCGTGACGCCCCCAAGGA
AGAGGATGCAGACAGCGCAGCGGGATCAAACAGGACGTTCGAGATCGTCAAGACGAAGTTTTGCGTGCTTTGTGTGACGAAGATGCGTGAATCTCGCAAC
AACGTGTTGGTCCCAGTACCTGCACCAAGTGGCAAGTTATCGGTCGTAGACTGTGCCTGTGAGGCTGTGGATCTTGGTGAATCTCGGAACTCGACCATTT
CTGAGACTGAATCCGAAGGTGGCCACATCTCGTTCTTCTCCGAGACGGGAAGCAGCGAAGGTGCTCGATCATTGCTATCGCCACAGTTAACTTCGATTTC
CTCAAGTATTAGCAAGATGTCGTTCGTGTCCAAGCTGGATGTTATTGACGATCAGTCCGTGACGATTCTGGGTGACCCAAGGATGATTGACGAGGAAGTG
ACGGAGGTCATTGACACGATAGATATGGTACCGGTCTCGACATTCAATTCATCAAGGCGAGTCGGAGGCTCTCCACAAGATACAGAAAACTCCAAGGCAA
GCCCAGGTAATACCTCCGATTGGTCTCCAATTGGTTCTAAGACCTCTCCGCGGTCCCTAGACCAATGTCTTGCCGAGCAGGAAGAGTTGCTGCGCCGCAT
GATGCTCTCAGCCAGAGGTATGCGCCACCAAAACACGAACCCAGGAAGCGGGACCATGGGTAGCAGCGGGTGCAGTTCCTCCGGTGGCATCCAATCGGCC
AGGTCACGTCCCGATATTACACTTTTTGAAGGCTAGCTACACATGCAGTCCTGTCTGCAAGAAGCATTATAAGTTTAAACCTAAGCGTAAGTAAGTTGTT
GTAATGCGTTGCCAAAAGCCATATTGTACTGCTCGACACATCGACCTCGGCCTCTCGAGATTGGCACAGTCTCTGCTGCCTGCATCGCTGAGTTTACGTC
CAGCTTCGAACCAAAAGTGGAGGAATGCCTGACTTCAATGTTTCTTTCAAAGCAACTTCGGTGATCCTGCCAGACTTGAGCCACGTGGTGGTTGCTTTGC
TTCAAAGGAGCCTCCAATCCAACGTCGCGCGATTTCTCTGGCGTGTCCACATCGGAAGAATTTCTCAGCCATTGCATCCTTTGTGTTTTGCAGCTGAAGG
ATGATGCCTCCTTGGTTGTGGTGCCGCGACAAAGAAGCCATTTGACCCTGCACTTCAGCAAACTGCAGCACTGCAGGAAGTGGTCGAAGCACTGCAACTT
TGCCAAGCGATCCGATCCACACAAACACGTGAACCGGCTTCCGTGTATGGGGTTAGCCAGTGATAACCGCACTTGGTTACTGTATGAGCTCTGAGACGCG
CGGACGGATCGGAGCTCACGATCCTTCGATCAAACGAGCATTGCCAGCGCTGTCTCCACCAAAGAGCATACTCCGCCACCTCCGTCGTCTACTCATTGTG
TACAAACACTGTAGTTAAGCTGCATTGCTCAACCTTCACAACGGCATATTCAACTCGTCCTCGCGAAAAAATCAAGCCGCTCCGTTGAACGACCGCCAGT
GTGAGTGCCTTAGTATCGCAGGCCATCGGATGGAGCTCATTCGCCCGCAGCATCGGCAATCAACACTTTCTCACTTGCCAAGTCGTGTTGAGTTGTGTTC
GTCGTTCGTTCGGTCCGCCTTACCAAGAGTGGCAGTGGCTTAAAACTCCACGACCGAACAACCGAGCAAGAATCTTCCGTCGCTCACGCCTCATTTCTTG
ATACTCTTCAATCGACGCCATGCCACGCAGGTCGTCGTCTTCCATGCCGCGCTCGGCATCCGTTAGTTCCACGACATCATCGTAAGTCGCTTGATCATCT
GCCTGTTTGTCAAGGTTCTGAAGTTTGTAACGGTCGAACCGTTGCTGAGACCTTATCTTGGTGCTCGTCACTAACACGATCGTGTATCTTACAGGTATCG
AGCTGGCAAGCTTCAGTTCCCTCTACCAGATGATTATTTCCCACCGGTGAGCCTTTCACTGACCCAGGTGCAGCAGTACCAGGCACAGGTGGAAAATATG
GTCACTAAAGCGATGGAGTCCTGCATGAACCACGAGAACCGAGTCGCTGGTTTTGGCCTGGAAGATGAAAGACGCTGGCAGGACGTTGCGCACGACTCGG
ATCTGTCTATCGTGCGACGCAAGCAGGGCCTCAATACTATCACGCGTACTTTCGGAACGGTGACAGGGGACTTCCGTCGCTTCGTGGACTTCTTCTCGTC
CGAGACATCCGAACAGCTATTCGCATGGAACCAATTCTTTTTCGGCTGCGCTGTTGATGCGGTGGTGTTGTGCAACTTGGACTTGGATAAATCAGACAAA
CAGGCTACACTCGGAATCAAGTGGACATGTATGCAGCCCTCAGTGCTCACGCGTAAGCGTGACGAATGCTTTCTCGAATACACCGTGTTCAAGAAGGATG
ACCAGGGCCGCGATGCTGCGGTCATCGTTCGTATGCCTGTAGATATCCCAGAGTGCCCACCACTACCACACGAGCTCAAGACAAAGCGCGAAAAGATCAC
GACCGTCATGGTAGTGCGTGCGTCCGACTCCTACCCGAATGCGACTCAAGTGTTTATGCTGAGTCAGTGTGAACACAAGGGCCTTACGGCTTCCACTAAG
TACTGCAAGAAGTTGCTGCGCGCACTGAAGGATATCTCGCTCTCAGCCGATGCCAAGCGCATTGCCACCACTATTAGCACACCAGGATTTGTGGAGCAAT
CGCGTGTCGGAGGAGAGCCTCTTGGTATGGGCGACACCATCCGGCCTTGGGTGCCCACAGGTATTCAACAGGGCTGCACTAGCTGTACTCGACCCTTTCG
AGCTGGCCACAGACGCCGTCACTGCCTGATGTGTGGCGATGTATTTTGCACAAAGTGCCTTGTCCGACGAGCTGGTATTCGACAGGAGAAGAACGCCTTC
AGCAACTATGTGACGATGACGAACCAGCGTACATTCCGCGTGGTGCAGTCGTTGTTCTGTAAGGTATGTGTCACCCGCTCCCGTGAAGAAGACGCGGAAG
CGATCCAAGAGCAGAACGAAGCCGCTCGCCGCTCTGTTGCATCTTCCAAATCCTCTTCAGTGCCACGTCGTTCGTCAATGGGATCATCGTCACAACCACA
GAGTTCCAAATGCTCCACTCCGACGTCTTCAACACAACAGACGGATGCTCCTCGCCGCAGCGCAACTTGGAATGAGGAGAACCGCGCGTCTTGGTGGTCT
GAAAACGAATCGGACACGTGCAGCTGGAAGTCTGGATCAAGTCGATTTAGCACTGTTTCGCGCAACTACAGCGGAGCCCCCACCGTACGCTCGTCTTTCA
GCTCCGAGTATTCATTGAGCAGAAATTCATTCCTGGCAGTGCAGTCTCTGGAAGCTTCCCGTGAGATCGATGCTGACCTAGTTGACGACCGAATCGACGA
GCGCTCCAGCATCTACGAGGTGATCGACACGAAGGACATGCTGTCCGAGTCCGAGCTTCAGAAGCAACTGCGGAGCCAGCAGCCCTCTGTTTCTGAACAG
GACGCGGCGGACGACGACTACTTCAGTGAGTTCCCCGATATTACCCGTGCTCGATACACATCCACACCAGTGGCGCCGACATATATTCCGCCACGCTCAA
CCGCTCGACGCACACGTAGCACCGACCAGAACGAAAACCCCGCTACTTCCAAGTCGCTGGACCAGTGCATTGCTGAGCAGAACGAACTTCTACAGCAAGT
GCTATCCGCCAGCCGCGTCTTCACGTCCGATACTCAGACACCTTCAAAGCCGTCGTCTGTCAGCAGCTTCACTGACGACGACGACGGGCACGACGACAGC
GTTTATGAGCTGTAATCCCTCCGTCTAGTGTAGATAGAGGCGTCCATCGCGAAGCCAGCGATGATAGTAAACCAACCACTCAGCATGCTATGAGCAGAGT
ACACAAGCAACCTAATGACTATCAATGCAGAATCCATCACTATTTGGTGCAAGAACTGTGGTGACAAACGGGTTAGTGTCCGCTTCGAGACAGCTTGGAA
TCGCCAAGTTGGCTAGTGGTGCTGCCGTGATTGCAAGTGCATTCGGTGGGGGTTCCCATGGTGCTAACTGTTGATGAGTGCAGCACTTTTGCGTGGTGAA
GCGGGTATGTCGATGAGGCACGCAGATACCTCTTGTGCTTACTCCATGCTGGCGAAGACGAAGTCGCTCGCTCTCGCAAGATAAATCCGGCCGCCTAGAC
TCGCTGCCCGCAAGCTCGTATCAACTCATCCGTGGCCCCATCTGGTCGTTCACATCACCACCTGCGTGCGAGGACAACTACACTCTGCAGCTGGACAGCA
CTCCACTACTCAACTCGCGGCCACAGCGTCTGCCACGCGCCCGATTCAATCGTAAGGTCCACCAGCTTCTCTACATTACAGCGCGTCAATAACTGATCCG
CTGTGTTGGATATGCTAGGTTTGAAATGTCTGTTGCTCGTGCCGGCAAGGTGAGCTCGTTCCCTGTGCCAGATGACTACTTCCCGGATGTCCATCTATCG
ACACTCCAAGTCCTCGAACTCGAGGAGAAAATGACACTCGCCGTGAAGAACGCACTGGCCGACTACGATCTGCACGAAGCCATGGGCTCGAACCCGATTT
ACGGCAAAGACTGGAAGACACTTGGCAAGGTCGGAGGTCTCACAACCGTCCGACAGAACGGCAGCGGTGATGGTGCTGTCTGCCAATGCCGCATCTTCGG
TCGCATCCACGGGGACTATCGCAACTTCCTCAACTTCTTCTACGCCGAGACTTCCAACCAGCTTTTCGCCTGGAACCAATTCATGTACGGCAACGCCATT
GACGCCGCCATCCTGAAAAATATTCACACGAGTGCATCGGGTAAACCGCACTTGTATCTGGGTATCAAATGGACGTGTTTGCAGCCGTTTGCACTCGTCA
AGCAGCGAGACACGTGCTTTCTGGAATACATGGCCTTTACGAAAGACTTACGGGGACGTGACGTCGGTGTGCGTGTGAATATGCCACTTACTCTACCCGA
GTGTCCGCCCTTACCTGATAAAATGAAAACCAAGCGCATGGAGATGCTGATCGTGTCCATCGTTCGCCCCACTGACGGAGATCCACACTCGACAGAGCTG
TTCCTCATGAGTCAAAACAACTTTGCTGGATTTGCCGTTCCCGGGTTTTACTTCAAGAGACTTATGACCAAGATGAACGACATGGCTATCTGGGTAGACT
CAAAGCTCATCTCAGTCCATGGCATGATGAAGCGGGATTGCTGGGTCGATAAGAAGTCGCGTACTGAGTGTCGTTTGTGCTCGCGCGATTTCTCAACGAC
ACGCCGTCGCCAGCATTGTCGACTATGCGGCGAGGTGTTTTGTCGGCAGTGTTTGGTCTACCGAGGTGCACGGGAAGACGAAGATGGCGAAACCTCTCAG
AAGACATTCACCGTCGTACAGATGAAGTTCTGTCGTGTGTGTGTAGCTAAAGTGCGGGACTTGGACGTGACGTTGCTGGCACCAGGATCGCATGGCAAGA
TCGAGGACAAACCTGCACCGTTGAACATGTTCGCGGACTCCGGAGCGTCGACAAAAGCTGACGGTGAGCACACATCTTTTGGTTCGTCTGCAGACTTGCA
GGTCTTGCAGCACTCTTCATCCGGTTCTGAACTACTTGAAACGATTCGATCATCCGGCGACGATGGTATTGTAGATGACGAGCACAGCGAGCTGGACGAC
GTGCGGCAGAAGTCCATGGGCGTTGATATGTCGAACCTCATGTCCGCGTCTCAAATGATGCGCCGGATTAACGCTGGAGCCTTCAACGACGACGGCTCTG
CTCGCCAGCAGGCCAATAACTCGGACAAGTTAGTGTCGAGGCGTACCATTGATCAATGCATTGCAGAGCAAGAGGATCTCTTGAGGAGATTGATGCTCGC
TGCCCAAGACAGAGCACAGCCCTAAGATCGAGCACCATCGCACCGATTCAAGATCACACCAACAGCAGAATTTATCAAGCATTGTCGTAGTGACGGAGCC
GATACTGCAATGGATAGCCGTCACGCACGCATGCGATCGCCCATCGTGCTTATCGTTTTGACACAAGGAAGAGTGTTTCCTTGTCGAAGTGACCATAGTT
CACTGGTATCACCACCCGAAGTAACAAATAATTTTTGCTCAAATTATTGGAGCTCGCCCGGTGAAGGTGATGCCAAGACTTCACCATTTGATGACACGAG
CGTCGGACTGAAACTTCAGCGACGGCCTTTCTTGGTTCTTCCAGTCATTCGCGCCTCGCGCTCCCATGTCCTGGTGCTGACAAACTCGGTTGATAAGCGT
CGGGACTGAAGTCACAATTGACACGCTGAATCAACTCGTTCAGATCACAGGAGAGACCGACTTGAAGCTTTGCACCACGCGTGGCTTCAGACTGACGTTG
GGGTCGTCTTTGCTGAGCAAGGTGCTCCACAATTTTGTCAATGGAAACCCATTTGCTTGTAGTGTTGTTGTAATCTCTTTTCTTATGAGTAACTTGGCCA
CTGAACATTGATGGTAAGTCCTAACACTACTTACTACGTGTGATGTACGTGACTACCCTGCAACTTCTACAAGGTGTCATCGTTAGTTGTTTTAGTTCGA
ACTTGATGCGAATATTTATTGCTGTCCACGGGCACTTGGTGGGTAATATCCTGTAGTCGAGTTGGCCGCCATCACTAGGCGCTTCAACAACACTTCCTGC
TCCTGAAGTCGCTGGTCGATCGACACATTTGATCGAGCCGCGTTGAATAAAGACTGCTCTGTTAGTGCGCCACCACCTAGAGGTGTTTCATCCAGCGGAG
ATGACACGATCTGCCGTGTAGTGGAAACAATCTGGTTCGAATCATCAATAATTTCGATAACGTCGTCCTCGATCTCGATAACATCGTCCTCATCATCGTC
TTCCTCCATCGGTGGTAACTTCCCGCTTCTGTTGCTTGAAAAACCATCAAGCGGTTCATTGTCTGCACTCGATGGAGAATCCACGAGGCGAACAGCCTTA
AAGTCCAATGCTGCAAGAGATTCCCGCATTGTCCGAATTTCCTCTTCTTCGACCTCCTGTACAACACGCTCTGCTCCAGCCATCGTGCGGAGGTGGCGGA
GGTCAATCATCATTGGGGCAACGGGCTCTATGACTTCGACCTCTGTCTCGTCGTCTAATGACGACGACACGCTAGTCTTTGTTTCGGAATGAGCCTCGGA
ACTCATACTTGTCGAAAACTTTTCTTGGGGCAAATTCCTGCCTTCGACGATGCACATTTCGTCTTCAGAATCCTCGGCAACCCCTTCTTGCGGTGGAGCA
GAACGCGCAGAGCTAACATCAACTGGCGATAGCGATGCAATCGACGAGTCACCAGTCAAGTCGTTGTCAAAGCTTTTGCCGCTGGACTTGTCCATGAACC
AACCTGTAGACTCGGCGTCAGATACGCCTTCATCCTGGCTGTCAGTAGCCGCGATGCTCTTAGCATCAGAACCACGAACTTTACCCATACAAGCTTTGCA
GAACACAGTCTTCACCACTTGAAACGTACGCGGTGTTGACGGAGCGCTATCATCAATCATCGGGGCATCACGGATCGTCATGCAACGGCGACAAGCTACT
TCCCCACAAAGACGGCAGTGCTGTCGGCGTCGCGTTGTTGAAAACTTGCGGTTGCACACGGTGCAGTTGGTGGACGCCTTCTTTGGCGCCCAGCTGCGGC
GATCCAGCATGCCATGCATCGAAATGCGCTTGGAATCGGCAAACAACGCCATGGAGCTCAATGTAGTCATCATCTTTTTGAACGTAGCAACCGAGGAAGA
GTTCGACCCCTTGTACATGTCGATTTCACTTGTCGTGAAGATCTGAGTAGAATCGGCATTATCGCTCGTCGGGCGAACAATTGTTACCGTGTGAGAGTGA
ATTCGTCTGGTTTTCATTTTGTCCGGCAGCGGCGGACACTCATCCAGGAGCAGCGGTAGTGTGATACGGACGCCGACATCACGATCTTGGAGGTCCTTCG
TGTAGATGAGATACTCGAGGAAGCACATATCGCGCTTGCGCGAAAGCGTCGACGGCTGCATACAAACCCACTTCATGCCGAGGTACACGTGCGGCTTCTG
AGATTCTTTCGTGTGAATGTTGCACAGCACTGCGGCATCCACCGCGTAACCGAACATGAACTGGTTCACAGCGAAGACCTCCTGTGCTGTCGTGGAGTAG
AAGAAGTCGATGAAATTGCGGTAGTCGCCGTCGACCCGCCCGAAGACGCGTGAGGCCTCAACTGCCCTGGACGGGTCCACCTCGCGGATAGCAGTGAGGT
GTTCGACGTTGCCCACGACTGTCCATCGGGACCCGTAGTCCGGTCGAGCACCCATTGCCTCGTGAAGGTTGTACTCGGCTAGCGCGTTTTTCATGATGAT
CTCGACGCGTTGCTCATAGACTTCGATCTCGGCCGGAGTGAGCTTCACCGGAGGGAAGTATCCATCCGGCAGTGGGAACTTCACATTGGCGTTCATTTTT
GCTGTCGCGTTTTCCATCGCAGCAATACACAGGGACTCGACACCAAACGTTCCTTTTGCAGTGTGTCGACGCAGATCACTGCCACAGCCCCGTGCTTGAG
AGCTGTGCGCGGTTGTGGCTGGCCCGTCCACCGTGTGCAATGCTGCAACACTGCAATGCTGTCGGCGTCGCTGCAACTCGCACTTGCCTTCGCGCGCGCC
TTTCGCGTCAAGTCTACTTTATGCATGTGCCGAGCAGACAGACATCCAGTTTCGTGGTGCCGATCGATTTGCATGGGGCGGAAGGTCACAGCGATGCTGT
GGTGATCGAGCGGGAACGGACTTGCAGCTTAGTCGCGCATGGAGCACTTCCTCGGTCTTTGACGATGACAGCACTCCGTTCAGAGACCTGGTTCTCCATC
AACCCCTTATCGGACATCGTGGTCAATGTATCATCGTGCGCACGCAAGCTGTTGCGGCTACGGCTGCACGAGAGCAACTAGCCGGCGTC