Description :
From Genome Similarity Track
Location :
Scaffold_118:88214- 89893
Transcript NameFunction/comments
Sapdi_VS20SDRG_16206hypothetical protein

Sequence
1679 bases(100 bases per row)
AAACTCCACATAGCTGTCCAAGCAAACGATACCCAATGGTCGAATAGCGTGCGACGTTACTAGTACAGTGTATGATAGGAAGCACAATGAGTTTGGCGCA
TGGTGCGGACACAGATACAGTGTCTTGGCCTTCGCGAAACGTTGCAAGTCCAAGACGGTTTCTCTGCAACCAGCTGGTTCGTGTACGTGTCGTCCAAGGG
GCACAGCCCAATGTCGCCTTCGCAAAAGCTCACTTTTCAATCTTCCTTCTCTCCAGCATCGTACTCATGAAGCTCTCGTACCTTCCGCTCGCGCTCCTTG
CGATCGCCTCCGACCTTGTCTTTGGTGGCACCAACGCGCCTGGGCTGGCCGCCGGTGTCACAGGCGGCGGCAACGCAACGCCCGTATACCCCACAAACAT
CAACGAGCTCAAGGCGTACCTCCAAGACGCTGTGCCCCGGGTCATTGTCCTCAACAAGACGTTCGACTTTCGCGGCTCCGAGGGCAAGAAGACCGAGACG
GGGTGTCGCCCCGACTACACGCGCGCTTGCATCGCCAAGAAGAATGGTTTCCAGAGCCAAGATGTGATTTTGCAGGCCGGTGGCATGGCCAACACGGGCG
GATGCACCAACGGCACGCCCGTCCAAGTCTCGTACGACGTTGCGGCCACGAAGAACCCGCTCGTCGTGTCGGGCTCCAAGACCATCCGTGGTGAGGGCCA
GAAGGGCGTCATTGTCGGCAAGGGTCTCTGGCTTCGCGGCGACAACATCATTCTTCAAAACGTCCATGTGACCAACCTCAACCCGCAGTACGTCTGGGGC
GGCGACGCCATCTACCTCAACGGCAAACCCGATGGCTCAGCCCTGCAAAAGATCTGGATCGACCACGTCAAGATCTCGCTTGTCGGTCGGCAGATGCTCA
CGACCGACGGCGCTGGCTCAGACAGCATCACCGTCAGCAACTGCGACTTTGATGGCCACACAACATGGTCGTCGTCGTGCGATGGCCACCATTATTGGAA
CAACATTTTCATCAGCAACCTCAAGATGAGCTACATCAACAACGTCATCCATCACACCTCCGGTCGCGCGCCCAAGATCAACTCGTCCAACGGCAAATAC
TCGGTGCAAGTGCACGTCGCCAACAACTACTGGTACGACAACACGGGCCACTCGTTCGAAGTCGACCAGGCGTACGTGCTCTCAGAAGGCAACTACTTTG
AGACGACGGCGTTGCCCAACCTTGCCGAGCCCAACGGCTGGATCATGTCGACGACCAACGACAACAAGGGCACATGCAAGGCGGCGCTCGGCCGCGACTG
CGTCCCGGACGCATTTACCAACAGCGGCAAGTTCGTCGACCATGGCGCAAGCGCGGTGCCGGCCAAGATGAAGGGCATCGCGACGGCATTTTCGACGCAG
CCCGCCAAGCGCATTACCTTGTCGACGGCTAACTTTGGTGTCGGCAATCTCTAACTGTGCATTTTATCGTGTTGTCCTTTTCTAATATCAAAATGTTCAT
GAACGTCATTTTCAGCGAATTACTTTACTTTCAAATTTCTCCAAAAAAAAGTCCATCCCTCTATCGGCGCCAGCGCTTCGTCCATCGATTCGTACCATGC
TTGATGTTGGTGCTAGTCTCTATCTTCATGCCGAGCTGCGCTCAAATTGCACTACGATCTTAGTTTACATCTGGGATCG