Description :
From Genome Similarity Track
Location :
Scaffold_1894:882- 3530
Sequence
2648 bases(100 bases per row)
GTGGTTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACAAAGGCTGAGGTCACTGCAGATCCCCCTAAGGTCTGTCTGGTCACTGGATCCTG
TGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTA
GGGGGCAAGATCAACAATGAAAAAGCAATCCTTCTTCTAGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAG
TGGATGGGAGTCGGATCCAAGACTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGT
GTATTGGTTTGACATTTGGGTTGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATGGATTTCATGGTACCGGCCGGAGTGAGGTTGGATCTAGCGGAT
GGGACACCTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGACCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCT
GGATCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTGAAGTGGGTGGATTTAAAGTGAGAAACTGTGGGTTACTCGGGGCGAGAAATGGGTACCTA
CCGTAATCCAGGGGCCAGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGATAAGAGACTATTACTGGACCATTATGAGGAGATCGGGCGATGGTT
AGCGAAGGACGGTATCCCTAGACGACCTGGATATGTGTCAGTGCGATCCCGCCGCTACAAAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAGATC
AAGTCTCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGAC
GGGTTGAGATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTTCAGAG
GGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCTTATCGAGAGTGGCAACACTAGTC
AAACCAGAACCGTCGGGCTTAAACTCGTTAGAGAACCGACTAGATCCAACTGTTGGCTTCCCTGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGAC
TGCCACGCAAAAGAAGGCCGCGGTGTTCGGACCCAATGATGGATCCTACGAAGACGGAAGATGAGCAAGTTTGTTACCATGAAGGCGGGGATCTACACGC
CGAGGACCTGGGAAAAGGCATGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAA
CCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGAGCCGACATCTGCTGATTGGTAAAGGTAATGCGTTACCGCCTGCTGCCCGCGGAGTCAAAT
GTGACATCGATGTCGGTGACGCGAAACCGATCGCTCAGAGGGTGAGGAAGGTGGCGCCTCAGATCCGAGAAAAACTATCGGATCTGATTAAAGGCCTGCT
GCAAGCCAAGATCATCAGTTTCTCTACGTCCCCGTGGGCATCCCCAGTGGTAATCATCATCAAGAATGTGGTGTAGCGGGATCAGCAAAATCTGCGAGAT
TGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGT
CGGTAGGGCGGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTG
GAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTAGCCGTAGGGTTGC
CTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTGAGAACCTCTAGGGTGTAACCG
ACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGAGTAAAGGAAAAGCTCACTAGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTAC
CAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCAGGAAGGCACTTGCGTGATACTGTGCAAAT
TGAGGTCTGTATTGATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCTTTCATCTGCTAAATCCCTTACCAGGCTCGGCTGCATGTCCCTT
CTTCCCTTGACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCATGGCGTAATCATTATGGTTACCCTATTATGGGTACACTCATCAGGATC
CAGGTCGCTTGGATCCACTTCACTTGAAAGTGTACACTCGTCGTGGAT