Description :
From Genome Similarity Track
Location :
Scaffold_390:882- 2228
Transcript NameFunction/comments
Sapdi_VS20SDRG_17448hypothetical protein

Sequence
122 bases(100 bases per row)
TATACATAGAGTAGTGTCGTTGGGTACCGTGTGGCTCGGGATGAAGCCTTCGCCCGTGTCGGGGTTCTGCCACGTCATCTTGCCGTCCGATGGGATCGCC
TTCTTGGCGACGTTGGTGAGCG