Description :
From Genome Similarity Track
Location :
scaffold_280:882- 2177
Sequence
1295 bases(100 bases per row)
GAGTAAATCTTTCCTCGAAGGGGTACTCGGCAAAAAATCACCATTTTATCATTCTCTGTTGGGCGTCGCTGTGTGCACAACGCATGatttgtatagatca
caagatCTTAGAACCAAGCAGAAGCACCTTGAACTCGACAAAGGCATGTCTCATCGCATGTAGCTCCTTGCCACGAGCAACTAGTTTTTTCTCAGCGTCT
TTTCAGCCGGCAAGACTTTTGCGCGGTGACGTGCTTAATCTGATTGAAAGTTGCTTGAAACAAAGCATATAATATTGTGAAGGGCCAATTCGTCACAAGT
CACCTAGATTCCAGAGCCAAAATCAAAATCTGAGGCTTTTCTTCATAGCCTTGGGTGCGCCCCTTCTACCACATAATCCTTTCAAAGAAAATGAGCGTGA
AGTTTGCGTCATGTAGGCACAAtttgcactgtacttgtgcaagaagttggTCTGACAAAGCCTTATCTTCACGGTCGTTTGGGATAGAAGCACCGGCGAA
TCTACCGTGATTTTTATCTTTTGGTATCAGCCCGCAGGCCCCGGTAGAGATTTTGGTGGCGCCAAATACAGATCCATTAATACTGTCAAACGCATAATAA
AGCGCACAAATTGGAGCATAACTCACAAATGTTCAATGATGTCCTCCTCATTCCACGTTCCATACTAAGATCTACAATGCTCACGTACGTCGTCGAAATT
GTTTGTACATAGCTTCAATATGGTCTGAACAGCTGTGCCACCAGACTATTGGACGTTGATGGTGCATGAGACAGTCTCTGTGGCATGAATAGCCACTTGC
ACAACATCTCCttgaagtactcaccgcagTGAGAGAGATATAGCGGTCTTTATTCAGCAGTTGATAACAACCACCCGATAGATCGAGGCCACTGAACAAA
GTGCAGTCGACATGCTACTTTTTTAACAGATCCCTTCTAGGAATAATCCTTTGCACCAAAATCGTGGCTGCCTTTAGCTTATATAAGCATGCCCAACTCT
CCACTTGCTGTTAGCCTTCAAGTGTACGAAGATTTACTTACACCAAACCCGCACGgaagaaagcgtcaatgacgccacacGGTTTGCTTGGAAAGGGTCA
TTACCGATGCAAAATTTAGTCCCGGAAACCAGGTCAAAAGCATGATATCCAGGGGTAACAGATCTCTCGTTAACACGTCATGATTTTCTTTCAGCGAGag
aaaaattattttgaGATTTTCGAGAAAGCTGTAGCCCTCACTGAAAGAATTAACGGATGATGCGCTCAACTCCTTCGCTGGTAGCTGAACCATTT