Description :
From Genome Similarity Track
Location :
contig_60:88197- 89554
Transcript NameFunction/comments
g9058.t1hypothetical protein

Sequence
1357 bases(100 bases per row)
GGGTGTTGACGACCTGGTGCTGCTCCCGTCCGTGAACGAGACGTCCATCCTCGAGAACCTCAAGATGCGCCACGCCGCAGACGTCATCTACTCGTCCATC
GGGCACGTGCTGGTGGTCGTGAACCCGTATAAATGGCTGGACATCTACGGGGAGGACAGCATGCGCGCCTACATGCACAAGGCGCGCATCGACGTGCCGC
CGCACGTGTTCGCCACGGCTGAGGAGACATACCGCACGATGCTCAGCGAGGAGGACAACCAGTGCGTCATCATCAGCGGCGAGAGCGGCGCCGGTAAGAC
TGAAGCCTCCAAGCAGATCCAGAACTACATCGCGGGCGTCAGCGGCAGCGGCGCAGGCGTCGACAAGGTGAAGCGCACCTTCCTGGAGAGCAACCCGCTG
CTCGAGGCCTTTGGCAACGCCAAGACGCTGCGCAACAACAACTCGAGCCGCTTCGGGAAGTACTTCGAGCTGCTCTTCGACTCGGCTGGACGACCGCAGG
GTGGCAAAGTCACCAACTACCTGCTGGAGAAGTCGCGCGTTGTCAAGCCGGGCAAAGGAGAGCGGAACTTTCACATCTTCTACCAGGTGCTAGCCGGACT
GCCCTCTGCTGCCAAACAGAAGCTGCACTTGGCTCGGGGGGTCCAGAGAGCTACCAGTACTTGAAGGCTAGTGGATGCTACGATGTCGACGACGTGAACG
ACGCGCAGGAATTTGACGAGACCATGGCAGCCATGCAGCACGTAGGGATCAAGAGAAAACAGATTGAACTCGTGATACAGACGCTGGCGGCCGTGCTGCA
TATTGGCAACGTACACTTCCAGCCAGAGACCGTGGGGGATGCGGAAGGATCGTCCGTGCGCGACCGCGAGAGTCTGCAGATTGCGTGTGACCTACTGGGA
CTGGACGCTGCCCGTCTGGAACACGCTCTGTGTTACAAGCTGTTGCAGACGATGGCGCCTGGAGGCAAAGTCGAGTCATACGAGGTGCCGCAGAACACGA
GTCAGGCGAAGTCTCAGCGCGACTCCATCGCCAAGGCTGTTTATGACCGACTGTTTGATTTCTTGGTGGAGCGTGTGAACCACGCGCTGGACATTGAAAA
GAAGGCGGAGAAGCATGGAGATCCTGGAGATCGACGATATGACCACGATTGGTATCCTGGATATCTATGGTTTTGAAATCTTTGACAAGAACGGGTTCGA
GCAGTTCTGCATCAATTACGTCAACGAAAAGCTGCAGCAGATTTTCATCGAGCTCACGCTGAAGAGTGAGCAGGAGGAATACGCTCGCGAAGGTATCGCT
TGGGCCCCGATCCCGTTCTTCAACAACAAGGTCGTGTGCGATTTGATCGAGGCGAGG