Description :
From Genome Similarity Track
Location :
Scaffold_37:88190- 91027
Transcript NameFunction/comments
Hyaar_Emoy2805272hypothetical protein

Sequence
2837 bases(100 bases per row)
TCCAAGTATCTCGTCGTGGCCCCAGGTTGGAGTACCAGTATGCCAAAAAATTCCTCGCGTTGCACCTTCCAGTTAAGAAAAACCAATTTACTTTTGTCAG
GTTGCACCTTCAAGCCAGATAATCGCCCGAAACCCTCGATGATTTGCAGCACCCGAAGAAGTTGCCGCGCCTCCTGTAAAAAGACCGTTGAGTCGACAAC
AAACGCTGAGAATTCGGTTCTCTCGCCGCTCTAGGTATACGTAGCCCACAAATCCCGGCATCTTGTTGAATAGCCAAAGCAAGGACTTCCGCCGCGACAA
GATGAAGTATCGGGGCAAATGGACATTCTTGCCTAGTGCCCGAAATTACCACTAGCAGCTATAATAGTGCTCCATTCACCACAAATTGGGCAGATGTGCC
GTCGTGAAAACTCGTTAGTTAGGTAACAAACTCGGGAGAAACTCCAAAGCGCTGGAGCGCCAAGAAAATAAAAATACGGGCGACCGTATCGTATGCATTG
CAGAAATCTAGCAACAGGATAACCTGGCTCATCATGGCCGTAACATCTGGCTCGGCGGTCGACGACGTCAATACTGCCATCATCATCATAACGGTCTTTC
GCATCTGTCTTCCATGGACGAAGCTTTGATGTGAGGCTCCGATCAATGTCCTTAAGACTTTTTGCACTCTCGTAGCAATATTTTAGTGAATATCTTGTAA
CCAGTCTGCAGGAGAGCGATGGGCGGTAATCCATCGCATCATCCGAGTTGCTGCGCTTGCGCAGTGAAATGATTAAACCTTTCAAAAAGTACGGGGAGGC
TTGCCTCCCCGGAGTAGCTGATTGCTGAGAGCTAATATTGTTGGTACCATGAATGATTGAGTTTCTTTGAAAAAATCAGTTTTGAGGCCATCTTCTCCGG
CTGCTTTGTGCCTGTTAAGTGCCGATATCGCTTGGAAAACCTCGTCCATAGAGATAGTGCGCATTATTTGATCGTTTTGATGGACCCCCATGCGTATGGT
GTCAGGTATCTTCACAAATGCGTCAAATTCGGTCCCGAGATGCGCAGACGACGCTGAATTATGTACAACGCCTAAAATAGGCTGCCACTCCGACGCGAAT
CGGTCTGCGATCGTTATTTAGCGTCTGAAAAAAGCTTCATTGAGGTGACGTATTCGCGTAATGGTTTGATAGATTTCAAGTAGACACGTGCTTAGTTTTC
CAACGAAGTTGCTCCTTCGTTCGTTCCAACCATTTTTCTTTTTGTAATAAGTGCTCATCCATAGCCTCTGCCACTTTGACTGCTTAGTGGCCTTCCTCGA
GTCAAAATGAGGGTTTGACTATGCGCTTGAATTCGACATATTACCGATTTATGACGGCGCTTCTCTCGGGTTCGGACGCGCTGAATGCACTTTACGCACT
GCTACACTGTACTATCCCACGTCTATCCGGTTACTGCATAACCCACCCGTGCAGCAGTTAGACCGTTCAATAAATTCTCGATGACCGGACTGGACTGAGC
TGTGGGAATAGGGTACATGACCGGACGCTGTTTCCGTCGAGAACTCTCTACGGGGCTGGTATCTTGGCGATGTAAGTGCGCACGTTGATGATCTGACCCG
ACATGCGGTTACTCGACAGAAAACCATTGTACAACGGAAGACCAGAATTGTGGAACGTAAAATCGGTCGATACGACTGGCCGGGTCCCTTCCCCAGTACG
TAAAAGAATTAATTAGGTCCAGCTCCTCGTCCTCATCCTCCACACTATCGCTGAGATCTAACAAGTCCTCCATATTTAGATGGTTGAGTAGGTTCTGTAA
CGCAGTGCACTCAGGTCGGCCCGACCTTATCCGTCCGAGCCTGTCGAGAGCAAGGCTTTGCAAACAATTAAAATCCCCAGCAATGACGATTTCATGCTGC
TGCCATGGCCATTGCTGCAAGCGCGTAAAGAGACTCTCATGGGCCGCGTGGCCGTTTGGTGCGTAGATATTTACCAATCGGAAGGCCCCAAGGGCGACAA
CATTTACGCAATTCGTCCAGAGCTCCAATTGCCATGGATGTGTCAACACGACCACTGTTGAATTTAATAAAAAAAAAACCGGTTCTACTCGCATCAACAC
TCCAGTACGACAGTGTTGAAGCTAAGTGATGGTGCGACCTACCCTACAATCGGGCCCACGAAGCCTCTAATTCAGCAGCTTCTCCACGGGAACTAACATG
CGTTTCTTGAATTATCCAGGCCACCGGTCGTTCCGTCGTGGGTGTACGCCTCCAGGCTTCAAGCCATCGTGACCTTGTTTTGGCTTCAAAACCACACACA
TTTTGGGTTTTAATGCGCTTGAGCCTGCTATCCACCTGCTTGTTTGCTCGTCCAGTTGGTGAGAAGTGCGCCTTCTTTATGTAAATGTGACACCCGCAGG
CATCTGCCAGTCTCCCTTCCCCTACTTTGTCGGTAGATGAGGTTTGAAGCTTAAAGCAGCCCTTAGTAAATAAGTTGAGACTCTGCCCTTCCGTGCTCAA
AAGCCTCTGTAAAGAAGCCCGCGGTACTCAACCAATTCATGTCGGTAGTAGAACCACCGAATGCCTCTCGATACCTGGCGACAGTTTGAGTGCATCCAGG
TACCTGATAAGACGTGGGAGCGCCTCATTGTCGTCGTTGTCTTCTTAACCAATGAGCACTCGGATCTCGTTTTCGTAGAGACTTGCACAAAGTATGTGAT
GCGCAAATAATTGTTTTTTCACATCAAACAGTTTCAAGATGGAAACATCCCCGTAAGAGTTGGCTCTAAGGCACACCTAGTCATCCCTGCTATCGATAAG
TGACGGTAAATTGTGAGGGGATGGCCTCGAGATCTTA