Description :
From Genome Similarity Track
Location :
Scaffold_438:8818- 18139
Transcript NameFunction/comments
Phyag_g5707hypothetical protein PHYSODRAFT_314592

Sequence
9321 bases(100 bases per row)
GACCCAGTAATTTGGTGGTTTGTCACTCGGAAGCTGCACGGCGATAACGTAATTGGTGGAGATGCCAGTGGTGGACAACGTGCCTTGCCGTACTGATGTC
TTGTAGACTGGACACGGATACATCATGGTGCCAGGAGCTAGTGTCGGGTTGCTGGCTACTGATGATGAGGCGGGCAGGAAGTGAACGATCGACATGGCGG
AGAACATCTCACCGGGTTTGGCGTCCTCTAGTAATCGACGAGAAGGGGACCACTTTGCACCTTGCAACCAGAGACCGTCGACGTAGATACCGTCGGTTGG
ACTTTGTGTGAGTTGTTGGGCATTCTCGACGTCCATCACGGTGAAGGTGAAGGCCAGCGAGTCGATGGCGGTTTGGTATTTACGAGCGAAGTTCTGCAAC
GTACCAGTCATGAAACCTTgagggaagaagaagacgtttaACTGGAACACCACCGGTTCGCCATGTAGCAACCATTGTCTGAAGAACGTGACGCGATCCA
GCAAGTCGCGCACCCACGACGCTAGAGGTTTGAGTGATGCGAAGCTCACGGAAGACCAAAGTTGCGGTACACGGCCATTCAAGAACGCCATGTACATGTT
GTCCAAGTCCGAGGACATGACGATGAGTCCGTTGATAGCCTTCTGGATGTCTCTCAACGACGTCCGCATTCGACGCAGTAGCGTGTTAAATTTGATGACC
TCCTGACCCAAGACGGTGGCTAACGAGTCCATTACAATTGTGCCGGCCACCTCCCGAGTCTTGAACGTAGTGGgtccagcttcttccacgTTGAGATCAG
CAGGCAGGTTTTCCTGAATGGAGATGGCGAGATCGAGCACGCGCTGATCGTTCGATttgcctccaccaccgccgccatcTCGTGGCTCGAGACTTAGGAT
CAGCTGCATCATGTTGGCACTTTCGTTGCGCTCGTACGTGACGTTGGCATTCTCGTGCATGCCGAAGAGCTCCGGGTTATCGAACGCAGGGAGCGCGCTC
AGATATGACTGAACACTCGGATGTGAAAGCTCCGTTGGCACGTGGTAAATACCAGAACTCGAGTACGAATGACCTGTGTTGAGCACCTCTGGCGTGTAGA
AGTTGCTGAGGATGCTGGTAAGACAGCGTCGGTCCCAGTCGTCGGTCACGCGTCCTCCGTAATTGATCTGGCCGGTAACATACCGAAGAGCGTCCCAGGG
GATGATAGGCTGCTCCTCCAAGAATTTGCGCAGACTTGCAAGCGATGTTTCCAAGTCTGTGTCGTTGAACTCGTACTTGATGTTCCAGCCGAGAGCACCA
AATTTCCGTCGTTCTTGGACGATGGCGTGGAAGAACGTGAGTGCACACAGCAGTGATTTCCAGACGAGGTCTTTCGGTTCCCCGGTATCGAAGTTCCCCA
GGTAGTGGAAGCTCTCGAGCACGTCTTCGGACAGTAAAGTGTTGAACGACCGTAGAAGATTGGCGCGAATACCTTTCGGGGGTTCGTTTGTGAGCTTGAT
ACCGTTCTGCAGCACGGTGACTGGGAAATACGCGGCGGGAAAACTCGTAAGGAAGAGACGGAACGTGGCTTGACATTGCTCGTCCGTCCGCTGGCCCATG
TCTTCCACCAGCTTTTCAAGTTTCGGCATCCAGGATTTTGCAAGATGGCAATTTTGCAGCAAGACCCAGTCGCCTACACCCTGAGAACTTTCGATGAGCT
TCTCAGCGCGAGGaccttggccttggccgaGAGAAATGAGGTGCAGACGATCGATGAACGACATCTCCTTCGCAAACCGAAGCAACATCCCAGTTGGATC
AGCACCGGCAGACAACACGAAGATACATGGAGTTTTCCGATCAGTATCGTTGTagatctcctccatcgtcgtgGATGCGTTGCGTCCAAATTCCGATCCC
ATTTCCGTGGAGATCATGTTCAGCACAGCCTGAGGAACCTTTTCTTCGGCCAAGcctcgaagcagcaacaccttcTGGAACGCGCTAAGTGCCGTGCCGT
AGCTCCCCGGACAAGACTTGGAGTTAGACAGGTACGTTGGGTCTTCAAGCCAAGCCAGCCAGCGTGGCCAGACGTTCGTCAGTGAAGCGCACAGTCCCTG
GAAACCAAAGACTTCTGTCTTCTGACCATCCTCGGCTCCTTCTGGAGCAGGAAGGTAGCTCGTCACTACCGTCTCGAGCTCCGAAAGCAAGTCCCATTGG
GCCTCCGAGATGTGTGCAGGCTGAGGATTGGGCTGTTGCGTCAAGCGATCACTACCTGGCGGTGCTCCACGGAGGTAGAATGACCACTCTCGAGCCGATA
TTTTGCCCGAATGCAACAGGATCTTGCAGCAAATGAGCATCGAGAAGAGCACCTTATGGACCTCAAAGAGTCCGCGGCAAATATTCACATAGATGTATCG
CGTCTGGAAGTCGATGAGGTTCgtgagtcgctgctggagtgtGTCAGCCTTCGGGGCTTCATCAAAGCAGATATTGAACAAGCGTTGGAAGAATGGCAGC
GAGTACTGGTACATCGGATCGATGAGGGCCAGATTGGCCACCACGAAGTAGATGATGGACCCACGCGTGGCCACACAGCGGTATTCCTCTCGTGCGCGAT
TGATCTCGATCTCTGTGGCTTCAGACTCTATCACGCGCTCCTTGATGATCTTTGACGTGACGTTCGACGACTGCAGTGTGTCGATGAGATCCTGGTCGTC
CAACACGTTACCTGACGATTCGGATAGCTGCTTCAAGATGCGGTCttcgatctccttcagctgcttcttaTCTTGCGCCATGGTTACTACCAAACGattt
ttcttctcctcgatgtCTGGTCGTTCGTGGCGCACAAcgtcaccaagaagctggtcCTCTAGACCATCCATTGTAACTGTAAAGTTGATTACAGTCACTT
TGATGTAAACCTCTGGGAGGTAGTGTGGAttcggcagcttcgtcgtGAGGAACAACTTAAACGCAGGGTCGTAGTCCACATCCGAGTCTCCAAGTCGGAT
CAGCACACGCCCACCTTGCTTGTATATGGCTTTCTGCAGGATTGGCTCCAATGATGGCTCCAACGTCTCATCGATGTCTTCGATGAGCAGTGCTTTGCCA
TTTCGGATGCAAGTTTCCAGCGACCGTAGCAGATTTGCGTTTGTCATTTTCGTGGTTTCGAGGTTGTGGGCCAAAGTTTTCTTGATCCATTTGTTGGCTT
GGCCCTGTGGGTCGATCATCAACGGCCACCGCTCGCCTCGAGTAACCAGGATGGCGTTATCTGTCGACGTCGAGTCTGTCGGAAGTCCATTTAACTGCCA
CTCGCGGATTTCGACGGGACTGCCAAGTGTAGTCGACAAGCTGTAGCCTGGGGAGCAAGGTATGGCAAGTTCTTGTGTCTGAGCGACCCACTGGTCCACG
ATCCTCTGACGAAATCCTCCGGTGAACGGACCGTAGTACGAAAtacaagctgcagctaagAAGGTGTCGCCAATCAACGCCAAAATCGATTCGGCCAACG
ATGCCACGCTCTCTTTCCAACGAGCACCTTCCACTGACAGCCCCGAAATGAGTTTCTCAGCGCGAACCAGTCGCTTCTCAGtcactgcagcgtcgttggC
AAGCTTatccttctcgtccagtgTGTCTTTGCATTGCTTTTCCAGCATGGCTACGTTCTCATTGACCACGCGAAGTTCTTCCTGCTTCTGGCTCAATATA
GCGTTGGCTTCGGCGAGTTTCTGGTTCATTCGCTCCAAGTTTTCCTTCTTTGGGCCGACCTCTTTCGCTACTTTGGAGTATACGTCCATGGCGTGCACCC
ACATGCACAGTGATGTAGCGGCTTTGGACACTTTGGACACCACTTCCACAGCCATGCCTGGTTCAGCCACAGCTTTGCCGAGTTTCTTGAGAATGGCCGC
TGGGATATTATCCTTGTCAAAGTTCTTAAGTTTatccaagaacgcaacaTCGCCCAGGACTTTCTTGGCGCCGTCCCAGCTTTGCTTCTCATTGAAGAGT
AGACACACAGCGTTCATGACCGTCTCGACAGCTTCTGGAGGCTTTGCGAACGACTTTACTTCAGTGATATCGTTCTTGGATAAACTATCCAGAGCCTTGA
TAGCATTGTTGAGCGCTGGCATAGCCACGTCGAGGTCCTTTTGAGCGTCAGCCTGGACGATTGCGACCTCCTCAGCTTGCTTGGTGACTGTCGCTTCATC
ATGCGAGACTCGTTCACGTACaaccgctgctgccttctGATCCACGGACACCCGCTTGAGCAATTCCTCGGCTTCGATCGCTTTCTTGGCCAAAatcggc
tgcagctcgatcaACTCGGACTTCAACGAATCTACGATGCTGTTGGTCTCTTCGAGTTTCTTCACACCAACTTCCATTCGGCTCTTGATCGTCTGTAACA
CCGCACGCTTCTCCTGCAACATCTTGAGGTACAACCCGATGAGGTCCAGATAACTTTTGGGCGTCGTGTACACGTagcgctgcagttgtgaGAGGAACTC
CTCGCCGAAATCGTTGGACGTCGTGTGGACAATTGAGCACATATCCACAAGCGCCGTCCGGACGTCTTCTGAGGGCAATGACACACTCGCGAGCAATCGG
TCAGCCACAGATTGGAGTGCTTCACGTGGCCAATTCATGTACCAGTCGATGGTGCAGCAATTGATAAGCGATGGGAACGCTCGACAGCGAACTCGAAGTG
CTGAGCCAACGGGTGACATGGCCAAAACAATGTGCAGGTAATTGCGTACACGTTCAATGAATGTGGACACACAGTTGTCTCGTGTCTCGGggatctccat
cgccttgaCAATGGGCCTCATGTCGGCGATGACGCGATCCATTTCGTCTTGCGGGAACAGGTTTGGCACTTCTCCACTGTTCAAGACGTTGTTGATATCC
TCCAAAAAACTCTCTTCGACGATCTGGCTGTCGGTGAACAGAAATACAGTCGATGTACCGCCGACTCCAGCGCTGatcatcagcttcttgaggtcTTCGT
GGAATTCGTTGGTGCCGTAGCCTCGCGTGATTTCAATCTGGACGCACTTGGCTTCCACCATAAACGCTCCGAGGCGAGCTAGAGATTGTttgccactgcc
accaaCGCCGATCAGCATCGCGTTGCCTCGAGGTTGGCGCAGAATTCTTACCAACCGCGACAAATGCGCGATGGCGTCacggaagaagacgagatTCATT
TTATTCGCGAAGCTCACATTGTAGTTCTCGAGGAAGTCGTCCATGATCTTGGTGACCTTGGACACGTCGTTGCAGTGCTCGTACAATGGTGTTGGTACCC
CTGGCTTGAAGAAATCTCCAAAGGTTAGCGGACAAGGCGAGTGGAAAAGCGTCTCACGTGGCCAATTGCAGTTGAAAAAGCGCTGGAGTAGAGAACACAC
GAGCTCTTCAAACCACGTTTGGTCGGATGAATTGATGAGTCGATCTTGAAACACGCGCGAAGCCTCGTGCACCCACAAGCGATTCATCGTGTCTGCGTCC
GGGCATTTGGACGGGGTGATCATGAGAATTCCCTGGAAAACTTTGGATACGTCACGTAGATTGAACGTGTAGTGGAATTTGTTCGGCGTCGGCAGTAGCT
CAAGCGTCACTCGGTTGTAGATCTCGATAACGCTGGAGATAATGCCGTCTTTCATGGCTTTCACGGATGGCGCGAACTTCTCTAAGAACCCTCCGAGGAT
TGATGCAAAAATGAGCTTCAATGACGTCTCACCCGCCGGATACATGCTCAAGACGTGGAAATGGCGCACAAAACGCGGTGTACAATGGGACCGACCTCCG
cctgcaggtgcagcagctgctaACAGCATTGTATCTGCGATATCCTTCCAGAAGAGCTTATCACGATCGTAAAACCCGCCAAAGTCCAAGAACTGCCGTA
ACAATTCGATGGGAGCTTGAGCGCCGTACTCTTCGACAGCTGGAAGGTTCACGTCATCTACGAAGATGATCATTCGCTTCCCTGCTACAGGCCCCAACaa
gttcttgcgcttcttctcgagttTGTTCTCAATCGTCAACTGCGTGACTAGAGACGATGTCTGCGCTGAGAAATTGATGAAAATCGTCATGAAACTTGAT
GCCGAGGCTGACGGAgcttcgcctccttctccgtttGAGTCGCCGCTTGGTATCATGGGCCCAGACGTCAATTCCTGCAACAAATCCTGGACAATCACGG
TTTTCCCTGTTCCAGTTACACCCGTCACGTATGCTGGTctcttcgctgctgtcaaAGTTCGCAACAAGAACGTAAATCTCACGGAGTCGGGTGTGGCAAC
CGTCATCTTAAAGTACGGCACTTGAGGATTGTACTGGAACTTGGGGACAACGTCACTCCACGCACGGAATCTGGCCTGTTCAATGTCTACGAAGTAGTCG
AACACTAGACCAGTGCTTGGGATGCTGAGCTTCGCTTCCCCCATTAACTCTCGGGCGAAGTTGTCGAACTGTTCATGCGTATCGACAGTCATAGTCGCGC
CAACAGACCAAAAGAGAGAAAAAGCAAAGACTTTGTCCAGCAGTTCGAACATTTCCTCGTTTTTCATCGCCGAATAGTTCACTCCACCTGAAGGACTGAA
CAAAGTCGCAAACAACCGACACAAACTCGTGGCGAGGTTCATATCCACAGTCGGCACCAGCTCGAAGCTCTTTTTGCGTACGAACTGGATGCACTTTTCC
ACGTAACTCGTGATGAGGAATTCCAGCCGTTTGATCCCGTCCGGTGGGAAATCTGACGgtagctccttctccatccaaGTTTGCACGAACGGCATCCATC
CAAGATCTGTTGCAGTCATGTACACGACACCGATTCGACTCACAGTCGCAGGAGACGCCACCGCCAGATCCATGACCTCaaacagcatcttcatctcgct
CTTAAGCTTGATCCGCTCTCCGTTCGCAAGACACAACGTCATGTTGTCATCCAATACCGTGTTCATGTTTTCGATCCACAACGCATCGATCGGTCCGTCG
AATACAGTCCACTTCACGTCCGAGGTTTCGTCCGCTACAGCTTCGCGCATGATCGTCGAGGCTAACCCGTCGTGCCATTCCTGTGTTGCTTCGTTGAATT
CGCCGTACAGTTCGCCCATGGAAATGCACTTCGGATTGAGAACACGAGCATACACTGTTTGGTACACTGGGTTCTTGGATCCTTTTGCTCGCAACGACGT
CATGGTAGACTGCAGTATACGATAACAAGAGGTTTTTCCTGCTCCAGTAGGGCCCACGAGCGTACCACCAAAACGAACATTGAATATGTCGAAAAGCTGG
ATAACTTTTGTGATGTACGTGGGCACTTTTTGCAGTCCAGCCTTCGTGATCTCTTCTTCGAGAGATGCTTGGAGCTCACCGTAATCGTTTGGAGGGATGT
CTGTACCAGGGAACAAGTCGAGAACGATGGCGTGGAATAATGGCAGATCGTCGGCTAAGAATTTCGGGATGTTACTATCTCGTAGTGCTCGGATCAGCGT
CACGTCCTCATTTAAGTCAGGGTTTGCACGTTTGAGTGAGCCAGCCATGACCAGTACAGACTTTACAGCACGAAGACCGTAGTCGTAATGAGGTTGCTGC
GAAAGCTGTTCACTACAGAGAATGTAGAGCTTACACATCTTTCGAGACAACGTACGCGCATCGCCGAATCCCTCAGCGAACAGCATGATTTCGGCGATCA
ACGCGTAGTCGGGCACCATCATGGACACAGGGCGGAAGCATACTTTCAAGTTATCGGGGAGTTCTGTACGACCAGCGTAACCAGGATTCATGGTCACGAT
CACGTGGTGATCTTTGAGAAGAATTTCAATGCCCATGAAATTGATATGCTCTTTGCCCTGAATTCGACCTTCGCGCAGGatcagaagctgctgagccaCT
ACAGACAACACTTCGATGTCGATTCGGTTGAATTCGTCCAAACACGTCCAGTTTCCAGCCTGTGCGAGACCGCGGAAGAGTTTACCCATCATTTTATAGT
CGATCTGGTCGCTACAGTTGAACACGACGCACTGGATGGCCATGGCTTTAGCAAGAtctttgctgctctcggtTTTACCAGTGCCAGCGGGACCAGCAGG
TGCTGCCCCGAGTTTCATCCCGTACGCTCCTGTGAGCGTCATCCAGCAACGATCTGTCAATGGTGTGATCACTAAACGCGAAGTGGCGCCCATGTACTCG
TATCCGTACTGAATAACGGAGTCAGAGTGGCGTATGAGCACATCGTCAGCCTGTGCATCCCAGTAGTaacgaagttgctgctgccagatAAAATTCCCCA
CAGAGTCCACCTTCTCCGTCCACAGACTCTCGACAATATCGCGAGCGTGCACATCTGTGGTCACCAACGCCACTATAACTTTACGTTCCAATGAGCTCAG
ATCTCCACGGATCTTCACGATAAGTTCGTTTAGCTCGTACAAGTTGCGTTTGTACCAAGTGTGCATTTCTTCAACCGGGTTACTGCTGTTTAGCGCTTCT
TCAGTACTGCGAGCCCACGTCATCTGCGCCACAGTAGCTACAACTTGTCCAGGATGATCACACACCCAAACAGATCGCTCTTTCGTATCGTAATCCAAAA
GTCCGGCTTTCATCAACTTGTAAATCGACTGCTTCATACTCAGTTCCAGTGCCTTCAGCCAGTCTTCGACGTTTCCACGCGCTTTCAAGTTTTTCCCCAG
AGGCACTCGCTCATTCTCAGATGAATACATCGCAATCATGTCAACGCTGCCTGGAACGTCACCAAAGTCAAGTTTCACCAGGTTCTCAAAACATTTGCGA
AGATGTGGCTGTACTGCCTGCGGATTCTTAGATTGAGCCAGGATTTCAAGCAATTCGTCGTTGGACAGGAAGTAAAATCGGGGAAACGCCATCCGCTTCG
TCTCGAGATAGTCCTCCAAATTCTTCTGGATCTTGTCGAGGTGCGCGTTATGCTGCTGTAAAGTCTCTTTAATTCCAGGGAACGTACCCGAAGTCATTAC
GTGCGGGTTCTCGTTAGTACGACGCATGATTGTCTTCCAACTCGCGTCGACATGGCTGAAAATCTTGGACGCATCTGGTAGTTGGCGCTGGATATCAGGA
GCCGAGAAAATATTCTCCAAGTACATCCAATTTTTTTGTACTAGCAGCCATTCATCGAGTGTTTCTTGTAGAGTCACGAGTTTTTTCCTCCAGCCCTCAA
CTTCCTCTTGAATAGCTCCGATAAACCGCGAGCCCATAATTGTACTAATGGTAACAATCGAATCGTCCAGTTTTGCAGTGACCTCCTCGACACTTCCAAG
AACGAACACATCTTTCGATTC