Description :
From Genome Similarity Track
Location :
Scaffold_632:8818- 10795
Sequence
1977 bases(100 bases per row)
AAGAAGCTGCGCGTGCTCTGTCTGCACGGTTTCCGTACGAACGCCAAGGTGATGGAGAACCAGACGAGCTCGCTGCGCAAGGCACTTGGCGACAGCGCGG
ACTTCCTGTATCTCAACGGTCCGTTTGAAGCGGAGGGTCCCACGGACGCGAGCATCGAGCGCGCGCATGGCAAGGACGCGCCGTTCTACGAGTGGTGTCG
CATCAAGAGCGCGGACGAGGATGCGGGTGGCAACCTGAATGCTGCAACTGCACTCGAATCGACAAACAAGGAGTGGCGCTTCAAGTACGTTGGCTTTGAT
CGCACGATGGAGTTCCTGGACGAGCAGCTGCACAAGCACGGCCCGTTTGACGTCGTGCTGGGCTTCTCGCAGGGTGCGGTCGTGGCCACGACGCTCGCGA
TGCTGTACCTTCAGCGCGACGTGCGCTGGTGGAACCTCATGATTTGCGTTGGCGGTGTGCCTGTGCGCGGTGTAGAGCTGCAACACCTCTTTGAGAAGCC
GAATGGAGAGCTCAACCTGTTGCCATTCCCGTCGATCCACATCATGGGCAAGAAGGACCCGCTGTACACCGAGTCGATCAAGCTTGCTGCGATGTACGAG
CCAAACCCAGCGGGCGCCGCATTGCCGAAGGTCGTGCTCGAGCACAGTGGTGGTCACCGGTTCCCGAGCGAAGAGCGCAACCCGGGCTTCTACGAGAACC
TCGCGAGCCTCATCAAGAAGCACTGCGGCATCGACCCGCTGCCGAAAATGTAAACAGCGATCTGTCAGCAGTAGCAAGGGAGGATTGTTATAGGAGGCAC
ATCTATAGACGTAAGTGCACCTGCGAGTGGATAATAGATATACACTTTGCTTGCAGGTTGTCGTTATAGTTGTCCTTGCACACCTGTTGCTATTCTCCTC
CCTCGATGAAATGGCTTCAAGTGGGTGATCATGTAAAGCGCGTCCTCTTCATTCATTGGCTTAAAACTATCCAAATGTCAGTTATGATTGGCTGAAACTA
CGCGCAAAATCTTTTTCTCCAGAAAAAGTCACACAAGGGGTTAAGTCAACACGCGAAATGCGATGACGTCAAACGTTTTGTCGTTGTTGTATGGGCCAAG
AAGCAAGCAAAGGAAAGAAAGGCTAGCTCTCTTCGCCACCTCACTGCATAGCGCCATCTCCGCTTCACACCCACTCATTATCGAACGTGCCCGCCGCTGC
CCATGATGTCCGCCACCGCCACCGTCGCCCCCCCCTCCGCCAAGAAGAAGCTGCGCGTGCTCTGTCTGCATGGCTTCCGCACGAACGTGGAGGTGATGCA
GACGCAGACGCAGGGACTACGCGACGCACTGGGCGACAACGCCGAGTTTGTATTCATCAACGCGCCGTTCCCGTCGCGTGGGGATACGGACGAGGTGATC
AAGAAGAAGTACGGCGCCGACACGGTCTTCTACGAGTGGTGGCAGGTGCGGTACCTGGAGAAAGAGGAGATCGCGGACCTGTCGGCACAGCCCAACCCAG
CGGAGACCGAGGACACGTGGAACCTCGTGTTTGAAGACATCGACGTCGCGCTCGAGTACATGGACGAGCAGATCCAGAAGCATGGGCCGTTCGACATCGC
GCTCGGCTTTTCGCAGGGGGCGATCATGTGCACGATCCTATCGATGCTCTACCTGCAGAAGCAGAACGTGCGGCCCTGGAAGATGTGCATCTGCGTCTGC
GGCGTGCGCGTGCACGGCATTAACGTCCGTGAGCTCTTCGAGACCGACGAGGGCGAGCAGGTGCCCGTGCCGTACCCGTCGATCCACATCCTCGGCAAGC
TCGACACGCTCTACGATGAGTCGCTGGCGCTCTCCGAGATGTACGCGAACCACCCAAAAGGCTCACCGATGAGCAAACTCATTCTCGAGACCGAAAGCGG
CCACAAGTTCCCCACGCCTAGCCGCCACAAGCAACTGTACCAGGACCTCGCGCGTACGATCCTGCAGTTCTTCGAAG