Description :
From Genome Similarity Track
Location :
Scaffold_1421:8818- 9901
Transcript NameFunction/comments
Phypl_g13366hypothetical protein

Sequence
1083 bases(100 bases per row)
ttcttcacgtgCTCACCCCAAAGAAAATTGGAGAGTGAGGGTACAAAAATGCTACAACCACGTTGCCTTCAATTCANCGTTTGAATCGTTTCCTTTTTGA
ATTGAAGTCGGCAAAGCAAacgttgacgttgaagtgcgcaTTCTGCGGACACCCACGAGCCGAACATGGGGCGACGAGCACGCGAAGCGAGCGGTGCCGT
GCCCTGCTGGGCCCTCTACGCTGTGTGTGGGTTGCTATCGCTGGACTAAACGTGCTGTACCATGTCTTTCAGCCAACAGCACCGACGTCGATGGACGGAG
TCTGAAGCatgcgaagctgctgcgagacgGTTGGAAAGCGCCTTGGGTCAACTGAAGCTGCAGGGATCAGATACGAGAGGGCTCACGTTGCTCCTTCCAA
GCAGGACACGACTACGCCACTGGCGAAAGCTGGGGCTGGAGGACGTTCCTGGAGAAACTGCACTTCTTCCTGGACAACGAGACCGAGGGAGACGCGCTCG
CGTGGCTTGAGGACGGCTCGCAGTTTATCGTTGCGCACGCAATAGAAGCCAAACTGGGCCAACGACTAGGGCTGCGGGTCTGCTCGCTTCAtcaggtgct
ggaggcgctcaacTTCGAGTGTCTGGAAGAGAGTCACTGGGAGTACGCCATCTACCGTCACCTCTCCTTCAAGCTCGGGGACCAAGGCAAAATCGAAAAG
ATAGCAGGTCACGAGGCGCTGTCTCTCGGTCTCAGTACTGGGAAGGACATTGTGATGCCCAACATCGCCTACAGCTCGGAACTGAAGCCGTTGGAGGTTC
GGCTCAGTCTTCCGGATTCTCACTCGCAGTCTTGGGAGGTCACGATCGCGCCCAGCGCCCTGCCACGTCCAACCTACGACGCTACCGACGGGTTCTACTC
CCACGAGAGTGCTGCCTTCAGAAACAGCGCGGGGGAGAACTCGTGGGGAGATATGCTCGACAACTCGGACGAGTGGAGCGACCACGACATGAACTCGCCG
CTGTGGTGgtcgcagcgcagcgacttctccagcatctgTACGGACGATCTGTCCGACATGGACACGCTCTCTCAGATCAGCGC