Description :
From Genome Similarity Track
Location :
Scaffold_911:8815- 12364
Transcript NameFunction/comments
g14607.t1OWZ07258.1 putative membrane protein [Phytophthora megakarya
g14608.t1ABG66535.1 reverse transcriptase, partial [Phytophthora ramorum

Sequence
3549 bases(100 bases per row)
CACCTCCTACCTTAGTGCAACATGCACTAAGGGATACATTCAGGTGACCTCCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAAT
AACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACC
CCATTTACAATCAATACAGTTCTCGTTTAGCACCAAAGCTATCGTTCGGTCCCTTTGTCTTAGTTTAAGTATACTTGCGGATACAAGTATACTGAACTTA
AGTTAAATACACCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCC
GTCCAACGACCGACTAACACGTACGAACGCGGGGCTGAGAACCTGCCCTTGGACAGTAACATGTCCGTGGGTAGTCCAAACACGTCTGCAACGCATGTTG
CGCGTGCAGACTGCCCCCACCTGTCGGAACCAGAGTGGCAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCAAGCGGTAGCAACGATGTTGCGAA
CGCTATCACTGACGGAGCAACACGGTGTTGCTCTGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACC
GCGCGTGGAGTCATTGAAACTCCACGTAAGCAGCTACGTTGGAAGAGAGGGGGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCT
CGACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGGGCAAGGAGTTGAGCGTATGGACGCTGACTCACGGACCCTA
CGTGCTTTAGTACGTACGAAGAGTTCAAGGAGGAGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCA
ACAGGGCAAGCATGACGTGCATGCTTACGCCCAAAGGGCACGGTACTTGGTCTCGAACATCGCGACCAACCCGATCGACGAGGCGACAAAGGTCGTCACG
TTCATGAAAGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTACAATTGCGCTCGCAATGCAAGAAGAGT
TTAGCCTGAGGCAGGCTAAACTGCATGTGAACGCCCCGCGGCTAATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAG
TGCGACGGCTGCTGGTTCCCAGCAGCGTCGTGGATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACACCGGTCACTATGCCCGCGAGTGCACAGCACCT
GTGCACGCGGCGAGGAGCCGTCGTGGCGATACTGGGTATCGTCACGGGCAATAAAAAAACTAGATGGACCAGCAGGCGCGGGGCGCCCTGCTGGTGATGC
GGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGACAAGCCGAACCTGTCA
TCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACCGTGGAGCGTCGAACAACTTTGTTCGACTGCAGAGCCTTCCAAGGCTTGA
CTTCGAGGAGGTGGAAACACCTCGAAGTCTATTGGAAGTGAGACTAGCAACGGGTGTCGTTGTTAGAACCGAGAAGCGTATCGTACGCGTACGCTTCTCT
TATCAAGAGAAGGAGTTCATCGACGAGCTTATCATCCTGGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTGCACGGCATGATCCGG
TGATCGACTGGACGAAGCGCACGATTGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCACAGCACATGCACCATGTGGTGC
ATGCGGCCCTCCATCAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAACCG
AATCAGCAGGGCCTGATTCGATCGGATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTCGTGTCGACTGATAATGTCGACACACAATTTGTCGAAA
GACACTCCGCCGTTAGGCGTAGAGGTAAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCATCGGAAAT
GCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGACGAAGCGATGCGCGATCAAGCCGGGCTTGAACGCGTGCGCTCGCGGGTAAAACCCGCCGGTGAATAC
AAGGAACAACTGTCCACGGCCGGGCTGGACAAGAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAACGCTGCGCAGGTC
CCAATCAGGGACCGAGACGCTACAAGCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACAACCGTCGAGACATTGAGTGTCATGACGTGTACGAGTATT
GGTCTCCAATACAAGAAGATGAGGCTGGAGAATCCTCCGACGTTAGTGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAAC
TGCACGATGGACGCATCGAGCAGATCTGCATCCTCTCGGACGTCGAGAGGATGACGTGTGAAACAGAAGAGCTGAATCAGCTCATATCTGAGGGCGCGGA
CGCCCTCAGCGCGAAGTCGAAGAAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCTTGAGTACAAGGAT
GTACTCCCGGACGACATTCCTGCGGAGTTACCGCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCGACAGT
GGCCACTGCCGCGTGAGCAAGTCAAGGCAATCAACGACTTCTTTGAAAGTCGTCGCAATGCAGGACAAGTGCGGGAATCGAAGTCCCCGCACAGCGCGCC
TACGTTCTGTGTCAAGAAGCCACAGGGCGGGTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGGTGCCGGCGCAAACGCCGATACCTCGA
AAAGATGTGATCATCGATTCGATGACCTCGAGTACTGTCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCC
CTCTCACAGCGGTAAGCACTCCGAGCGGCATGCTCTGGGAGTGGCTCGTGATGCCGCAGGGGCTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCAC
GCATTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTATTTCGACGACGTGTTCATTCACAGCCGGGCTGTGAATGGAAAATCGGATGTGGAGATGCAT
ACAGAGCATCTCCGCAAGTTGCTTGAGCTCATGCGAAAGCACAAGCTCT