Description :
From Genome Similarity Track
Location :
contig_21:88137- 93167
Transcript NameFunction/comments
g4546.t1hypothetical protein

Sequence
5030 bases(100 bases per row)
CGACGCCATCCTTAAGCCATGCCAAAATGTGTTTTTGCCTTTGCTCACGAGAGAATAGCTGGGCAGTTGTCGTACAGCCAACTGTACATTTAGCTTGCAA
GAAAAGCAACAACTCGAAGTATCCACCAGCAGCAGCAAAATCCATCGCAGCGCTTGTGCCTTTTACCGAGCGATTGTGGAGCAACCAACGAACAGTGTTG
AAGTGGCCATTCCGAGCAGCATAGTCCATCGCTGCATGTGTGCAACCTTCACTACGGCTTTCATGAAGCCATTTCACCACCGCAAGATGTCCATTCTCGG
CTGCCGAGTTCATGACATCCGTTGACCACTCGATGTTTGGCTGATCGTGCAGCCATTGCAGCATCTCTAGGTTGCCATTGCGAGCTACCATACTCGTAGT
GTGGGCTTCGAAGGTCAACTGAGGGTGCTTGTCACGAATCCACTTGACGACCTCAAAGTGCCCCATAGTAGCTGCACCCGACAGCGCATACTGTGACAAC
GTTGGAGCATCATTTTTACCTTCTGCCTGCATCTCCACAGCAAGCGAATCGAGGAACTCCAGTACGTGCATATGTCCGTTGGTGGCTGCTCTGTCCATGG
CAGTGTTGTTGAACCAACTCACGCGAGATGGCTCGATCTCCGGGAAAAGAGGCGCCATTTCCCCAAACTTTTCAATGAGCCACGTGACCACATGCAGATG
TCCCTTTGAAGCAGCGTTGGTCACCATTTCAGATGGCTTGCAAACAATGCCAACTTCAGAGAGGTACTGCACGATCTCCAAGTGGCCGCCACGAATTGCA
CAATCCATTGCGAAGTGTGGATACTGCACAAGTTTACGGTCCAGTAGCGACCGCACTATGCCAAGATGGCCTTCCCCGCAAGCCGCTTGCAGGGCCTCTC
TAGCTCCTTTCGTGATCCATTTCCCCACGAGCCACTCGACCAAGTCCAATCGACCGTTCTTGGCTGCTCCCTCGAGTGCGCGATCTGATCCATCATTGTA
TCCTTGTTCGAAGATCCACTGCAGAATGTCCATATGACCTCCAGCTGCAGCGTCATTCATTGTCGGAGGAGGCAGGTGAAGCTCCGGTCTGTAAACATCG
TCCAGAAGCCACTGAACCAACGTCAAATCACCCATTGTGACCGCAAACTCCATCACTCTGCTCAAGTCTCTTTCAGCATCAGGAATGTTCTCATACAACC
ATCTTGCAACTAGTCCATGTCCTCCTTCAATTGCATTCTTCACATCTTCTTCTCCCCAAACGATGATATTCCGCTTCTCTTCTTGGTTGTCATAGTGCAG
CAAATGTTGCAAAACCTCCAAGTGTCCGCATCGCGCGGCTGCTTCCACAACTTCCACGCCCGCCGTACACCCCGAGAAATGATCCAAAAGCCAGCGAATG
ACCTCTAAATCCCCTCGTTCTGCCGCGGTCCGCAGCGATTCCGTGAATTGGTAGCGATTGTAGTGAACGTCCGATCGCAAGTACCAGAACAACGACCAAC
TCGAGTGTGTGTCTGCCGCAGGGTCACTGCTCTCCCAAATACGATCCAGGAGTCGGACGGACCCAAACTCACATGCCCGATCCAACGAAATCATGCCCGA
CCCGTCCAAATACGACGAGATTAGTGTACCCACATGGCCCAAAGCTGCCACATCAGGACGCGATTTCAACGCGAGCTGCACCGCCGCCAGCGCAGTTGTC
ACCATTGCTTCGAGTCAAACGGGGGGATATTGTAAATGTAGCTGGGTAGAGATTCCTCCCCGCAGGTGATGGTCCCTCATTCCAGAGACCTTCCAGCTGG
CACACTGACCACTTCCAATTTTGGCCTTACAGGAATTTGCGTCAATCTGCAACGAGTAAACCCCAATATTCGATGTAAATCGACTAAATACGACATACAA
AATTGAATGTTTAATCGTCTATATATTTGATATCCCTGTTAAGTCAATCAGTTGCGGGCGTTGCAGACTAGCGGAGGTCTTTGACCTTTAAGGCGTTTTT
CAGGAATGTGTTGCCCCTGCAGTAACACGAGGGCTTGTGCATTATGCTTGATTGTAGACGAATTGTCCGCAAGAAGAACATACTGTGCATAGGTTGAAGG
CTTGAGCATTATCGTTGCATTCTAAGGTTGAGTCTCGTTTCATCGATCAAGTGATCCACATTGGGTAGTGCTCTTCCAGCCATGCAAGGAGGTATTGTCC
TTGTGCGCTGAATTTCGTTCCCAGAGTGATCCCCTCGGTGCGCTGAGCGCGCAGAAAGAGAAGCACCTCGAAGCCCCGCAGTAAAATCTATGGGTTCATC
CGTACACCCTCGGTGCGGTTGTAGTGCAGCCAGCGAACAACGCCTAGATGGCCGAAATGCGCGGCATGGTTCATCGCATCCGTCGTACAGCCCTCCACGC
GGTTTTCGTGAAGCCATTCATCGTCCAATCAACATCCGTGAGTTCATATAGCCATTTCATTCCAAGCGGCCACTGAGAGCTGCCATGTTCGTAGTGTATT
TCAAATTCACTGGATAGTGGACATAAAGCCACTTGGCGACTTCAAAGCGACCCAAGGATGCTGCGGTTGAGAACACCTAGTCTGAGCAGATTGGATCCTC
TGCCTTCGCCGACTCCACGAGCGAATGCAGAAACTCCAGCACGTGAAGATGATCCATACCGGCCGCTTTGTCCATCGCAGTTTGGCTTGAATAGCCGTCA
TTATCTTCCGATCGATAGTATGGTGGGAAGACCGAGTAGGGCTCATCTCGATACTTCTCGCACAGCCATTTAACAATATCGAGATGGCCATGCGTGGCAG
CTTCGTTCATCATGTCGGACGCACCACCGACCATTTGCCTCTCGTTCAAGTACTTGACGATATCCAAATGACCTTTACAAATAGTGCTTTTCATCGAGTA
TAGAGCATATCGCCCCAATCTGCGGTCTAAAAGCCACTGCACCATATCCATCCGGCCATTCTTCGCTGCTAGTTCGAGCGCGTGGTCCGATCCGCCGTCA
TGTCTTGCTCAAAGATCCATTGCAGGATCTCCTTGTGATCTCCAGCAGCTGCATCGTTCATGGCTGGTGGCGGCAACTGTAGCTCCGGTCTATAGACAAC
ATCCAACAGTCAGTGGACCGTCGCCATGTCGACTTTGCGAACTGCAAACTTAATCGCCCGACTAAAATCCCGGTCTGCCTCATGCGTATTCTCGAGCAAC
CAACTGCTTCAATCGCATTGGTAACATCCTCCGACCCCCACGAAATCACATTTTCTTCTTGGTCTTGATCACTTCCACGACGTTCAGACTCCAAAAAAGT
ACTGCAGGACGTCCAGGCGACCATACTGGGCCGCATCTTCCACGACTTCCACGGACGCTGTGCATCCCGAGAAATGGCTCAGAATCCACTGCACGATTGC
CAAATCCTCGCGTTTTACCGCAGCACATCGAGATTTTTGAATTGGTATCGGTAATAGTGAATATCCGTTCGCAAGTAGTGACCGAGTGACCAGCCAGTGC
TTTTGAGTCGCTATTCTCACAGATTCGATACAGAAGTCGAATTGGTTCGGAGGCACAGGCTTGGTCCAGAGGAATCATACCAGATGCATCGAGATACGAA
GAAATAGCTCGGGCGACATGATCCAACGCAGCCACAGAGGGATGAGGACGCAAGGCGAGCGCCACGGCAGATAGTGGAGCTGCTGGCATGAAATCCCACT
TGCTGGCGCCATCGCTCTGACGGCGGAAGACACGGTCCTGACGCTAAGCGTCTACCTTTTCCTCACGTCCAACCTCAACATGGAAGACACCCAAACACTC
TCGGCACGCGCGCTACTGGGACAGCCGTGGGCGCTCAAGCGATCTTCGCGTTGTTCGTCCGCTGCCAAGAACTGGAACAAAACGTTTGGGTCATGCTTTT
CCCCCAAATATCCCGCCGACTCAGTTGGTTTATTTGGGAGGTAGACATCCGAACCGTACTTAATATTGGTATGGAATACAAAATCAATATTAAATCATGA
TATCATCCACTGAAGCACCCATGCTCTAAACCCACCACATCACTGGGTACCGGACTACGCTACTCCTAAGGCGTCAAATCTCTTTTATCGCTGTAAGGTA
GCAGAAAGCTTGGAGTTCCTGTCGATGCAATTGCATTGGGCTCAGCGTTTGGTGGCAATAAAGCTGTACGCGACGCCTTTAGTTGCTGTGCTACGGCATC
GTGCTGTGCTTCATGGATGCCTGGGTCATGGCATCCAATGCGGCCTCAAAATTACTGGGCAACTGAATGCCCGCTACCTAGCGAAGCGAGCCACAGTATT
GTACACCTTGCCAGTCTCCACATGTAGCTCCGCGACACAAGGTCTCCGGCACCGCACTCGGAGTCAAAGCAGCTATGCACGCGCATCATCGCCGGTCGAT
AGGAAGCCAAAATGTGACAGTCGAAAATGCGACGAGTCGAAGGTGTACCGCGAAAGGCGTAGACGAACAAAACCTTGTTCGCTTTGTCGGCCTTGCAACC
AACAAAGTGCATGTATTTAATACATGCTAGCTACATGAAGTCAGGTGTCGCGCGACCGCGACGGCCGCAAAATTTGTTGCCCTGACAACAACGGAAACAT
GCAGACAGCCATCCTTCGGAGCCAGACGGCTCGTTTCTGGTCGATGAATCACTGGCCGCGCGTTCGGGGATACATGTCCACGCTGGAGTCTTGCGGCAAG
ACGGAGCGCCGACGTCGATCGCCGTCCAAGCAGCTTCAGAAATGCAAGGACAGGCGGTCGGCATCCAATCATGTCGAAAGTGTCCTCGCGCGTGCCGGAA
TACGGACAGATTCAAGCAGGACCGTGCCCCTGTCATACATTTCGCAAGGCTAACTTTGCACCGGTATCGTCTAGAGATGAACGTAGACCGAGGCCTGGCC
CGTGCGTGCGTGTTGCGCTGAGCTAAGCCAGCCACTCAGCTGGTTCGGCCGTCTCGACGAAACATAGTTCTGGCCAGCTCTTCCTTCAGCTTCGCATTTC
GCAAGTTACCACCAAGGCCCAAAGCCGAAA