Description :
From Genome Similarity Track
Location :
Scaffold_68:88100- 89815
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17408hypothetical protein

Sequence
1715 bases(100 bases per row)
TTTTCTCTGGCCACACAATGTCCAGCTCTGTTCCATTGAGAGCCATCGGCTTTCGTACACTGGTCTCGAAGCAGAAGAGTTGCGTGTCTTCGTCATTCCC
AGCAACTACAGTCACGTACAGGAACGGATTGCACGAGAACCCGTTGCTCAGTCGCAGTTCTTCAAAGGATGACGAGCTGCTAATCCCTAGCCCAAGGCCT
TCCGACGGTACACTCATACCCGACGGGATAATTGCACGGACGCGAAGCGCATCGATAGCATAGGGTTTCAATCGAATTCGCTGCAATCTTTCAAAGCGCT
GACGAGCTTGTCGTCCTCGTAGTGATGCTTGAACTCGGATGATCGCAGCTTTCTTGTCAGCAAATGAAGTGGCGTCCTTCATCATACGCACATAAGCAGT
GAGAGCATTTGCCAGAACTTGACGTTGAGCAGCTAAATGAGCAGCTCGAACTTCTGCTGATCTCTCGTCATATTCGGTCTTCAAATCGGATTGACAATGA
GAGCACAGCCAGGACGAAAATGAGGAATTTGTTGTGGCTGTATGCGGAACTACAAACGTGAGCTTTGTCTTTCTGTCCTCTTGGTCGTAAGCCGCTAAGT
AACAGCGAGCATGAGCCACGACATTGCACGTAGCACATTCAAGCTCTCCCCCCGCGAAGTTGCAGTATTCACACCGAGAAGCACGTTGATGTCTCGTCCC
ATCGAAGAGGAAGCGTGTCGGAACAACCTTAGGCGGTGGCTCTAACGCAGAAGCTTTAATTTGCTCGCGATGGTTCTTTCTAACCACAACCTTTGTCACG
TCAGCGAGGCTGCTCCGCCGGTGAAGTAAGATGGGATCACTGTCCTGTCGACTCAGAAGGGATACCTTCGAGTGTTTCATAGCAATATTGTTCCCAGAAA
CGGTATTCATCTCGTCCAGCACGGTTTGCAACGACTTTCGGTGTGGTTTTCGGTATAACGCAGTGTCTTCAAACCGTGCAAGAAGCGGTGCCACATCACC
ACGCACGAATTCAGCTTTCGATTGACTCTGAAACTTGCTAGACCAATAGGATGAAGCGCGGTGTGAGCCATCGTGTTTTGAGGCTGGGTGCTGTTGCTCT
AGTGGACTGGAAATGCTCTTTCGTGACTGTGATATATCTCCACCGAGTTGAAGCGCAGGTGTTGAAAAAGGCGACGCGCTCTGGACGTATAGTTTGGCAT
TTGATTCAATAGAGAATGGTATGTGCACTGATGAGCTGTCAACACTGCTCCTTATTGGAGGTAAACGTGACGAGGAGCTGGATCCACGCATGTAAAAGTC
TTGCAACTCACTGCTCATGCACAATTACCACACATTCAGCTCTACAGCCCCCCAAAATACCCAATGTAAATTTAAAATTCACGGTCCGTAATAATGAACA
GTGGTGAAAGTTCACACAAACGCGTGAAACCCCATCGAACCTTGCCATCGATCGGACAAGATGTATTATTTCTATCTGTCGTCGCCAATGAACTTCAGAC
CATTGAGTATCCATCTAGCTACTCAGAACTTGAAAGTCGCCCAACACGAGCGACGAACCGAAATTTAACTGAGATTTAAGCGTGGGCAACGCGAGGAAAA
ACGAAGAAGTCTTGCTCTGGAAACGAAACGAATATAAGCGCTGCTGACTTCAGGGAGTGTGAGTCAAATGCGGTACTAACATTAGTACAACGAGCGTGCC
ATAAACAGGAGCAGT