Description :
From Genome Similarity Track
Location :
Scaffold_928:881- 2620
Transcript NameFunction/comments
Phyta_totarag11393hypothetical protein PITG_02691

Sequence
1739 bases(100 bases per row)
CGGAACAATCGCAAGTGCTGCGCCTGAAAAACAATAGTACAGCACGAAGGAGTCAGCATAACGACAGCTAAAGCGTGATACCTAATTGTATAAATCGCAC
CTGCTGGCTTTGTCGGGGGCGACAGCTGGGTTGTCTAcacgtcactgtcgtcgctggactctCCGTCGTTGTAGTCGTCGGCGCTGTAGTCATCGTCGCT
GCACGGAGGCGgttgcttgcgcttcttcttcatggacGCCATGCGAGCGCGAGATCGTTGAGCAGCACAGTAACGTGAGGGTAAAATCGCAAATTCTGGA
ATGAGCGATTCGGTGTCCAATCGGGTACGGTTCCATCACGGTTCACTCGTAATTTACGGTAAAATATATTTTCTGCAGTTGCGTAACATGCATTTTGAAA
GGTGCATTAACGACTGCGAGCGAACAATGGTAGTCACCACTGAACCATTTTTTTGTCTTGCTGTGCTTGACGATGCGCTGAATGACTAAACGAACTCGGT
ACACGGTACATGGACTCGCTTGTTGTGCCttgtacagtaatctgcgttaATATGCAACAGGTTACAATTAATAGCCTGACAAATTTTATACAACGCCGAC
TGCAATGCGACGAAAGATAGATGAGCAAGGTACTGAAGCAAAACAATCCATAAATTTTGGCGCGCGTTTTGCGCTATTCGCTGCTCGCTTCACTCCCTAC
GTCTTCACATTGCATTTCCTCCCCCTCAAACACTCTCCCAAATCCCCATTCCCAAGACGTCGACCAAGCGCCTGCGATCCACCTGGAGCGAGAAGACcga
gatcatcgagaaggCTACTTAAGCTCTCCCACTGTCGTACAATCAGTACGGCTTTCCTAGCGCAACAGGTggcatagtgaaatcaagtcagcagctgcga
gtgTAAAGTACGCGCTCAGTTAAATCAATACATATACGGCTTGCTCGTCTTTGTTCGCATCGAGATCACTTTATACACGCTGCCAACCaatatatatcag
gcgttgCCTATtaacgcagattactgtagTGTTATTGATGGTTGCTCCGTCGAGAAACGTTTTGGCGATACACGTAGGCGACGCTGAAACTTCCTCAGCG
AAAGCAAAGCACATGGTGATCGCAACATGTACACGGCGCTCGAGTGGAAAGAGCTGGTCTTCCAATAGAAACTGCTGCTCCCATACTTTGAGAGAAACCC
ATGGCTTTCTCTTAGCACGGCAGATACCGACAGTGGGCAGAGCACTCGCCGCCCACACACCATCTAAGCTTGCAAGCCACGAGCTCGAAGTGGCCCCGTG
GTGTATTCGTTTTACCTGCTGTTGCGGTCGCACAGATCGCAGCGACCACGGCAAGGGGCTACGAGTGCTGGCTTGGAGAGATGCTCCGGAACAGTCAACG
GTTCCGATGGCAGAGGCGCATTTTTCGGGGTTTGTGTCGCTCTACCGAGCTCTAAAGCGTGCTTTCGCTGCCACCTTTGATATTCAAGTTTTATTGATCC
ACCATGATATTTATTACATTAATATCACGTAGGTGGCACGTGCGAGAACAGGTTTGTGCGATGGCCTAAATACCGGTATGTTGAATAGTACTCAACATAT
CCAACTTGGGAGTGGAATGATCTCGAGCGCCTATCAGGACCCAGGCGATCAAGATCATTCCGTTGCGGCAGAGGTGATGCAGCCCGTGAGCACTCTTGAG
TCAAGAGTCTTGACGAAGTTCCAGGCAGTTTATTTCCGT