Description :
From Genome Similarity Track
Location :
Scaffold_1796:881- 1899
Sequence
1018 bases(100 bases per row)
AGGGAGCATCTCCTACATGCCACGGTTTTGGCTTTGCCAGAACCTGATCGGCCTTTCAGTGTCGTCTGGGACGCNNNNNNNNNNTTGCCATTGGCTGTGC
TCGGTTAAATACAGATGTTCAGGGACGCGAGCGTGGCATCGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCTTTAAGCACTGCGACTCAGATG
CCTCACCACTCTCAAAGATGTCCCGTTGGATTTTATTCTTTGCAGAATATAACTTTGAGGTGAATTATAAGCCGGGGATGCAAAATATTATTTTTGGCTT
ATGCGTTGTCACGCCGACCTGACTATGAGCTTGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGATAAAAATGTCT
AGCTTTTATACAAGCTCTTGGGAGAGATGAGTGTAAAGACTCGGACATTAAACTGTCGGCACGTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
AGGCTTGTTGTTCTATCGCACGGATGCTACGGATACTTCGCACGTCGTGTCGTAATTCCTCATGATAAAGAACTGAAGTATCGAGTCCTCTATAAGGTCC
ATGAAATAGCGATTAGCGGTCATCTTGGTCGTGGGAAGACCTACGGCTGAGTTAGCCAAAGTCATTGGTGGCCCAAAGTCTATAAATGGGTAAGCGCTTA
TGTGGAACGTGCCAATGGGTCAAACCCTCGACACATGCGGCTGCGCCGCTGGCTAGTTTGCCTGTACCCTCCGGATGTTGGGGGTCCATCAGCATGGACT
TTGAGTTTGGCCTACCAAATTGTCCGGTCGGCAACAAGGGTATTGTGGTCTTTTTCGACCGTTTGATCAAGATGGCTCACTTATCAGCTGTTCCTGACTC
AATTGGTGGTGAAGGTAC