Description :
From Genome Similarity Track
Location :
Scaffold_94:88081- 90582
Transcript NameFunction/comments
Physo_141105hypothetical protein

Sequence
2501 bases(100 bases per row)
ATTTATTCAGCTCTATCATAATTATTTTCTAATTTCACTTACTCACTACCACAAACGCAACTACAAACTCTAAACTACAACTAAAACTAGACTCAGCTCA
CATTGAGCTTTGCGGTGAGCTGCAACTTGCCTCCCTGAGTCGATCGAGGGACCCACAGCAGCAACGAACCCCCACCGGTACCAGGAAGCCCCAGGAAGCC
TGGGCGCCATCGATCCAAGTACAGCGTCTTGCCCCCCAGTGCCGTCACATTCGAATTCCAAGTCACGCTTTTGCCAGCCGGAACGGCAACTTCATCGATC
TTGGAACCACCAGACTTAATGTTGACAGTCACGTCCTTAGTGTCGGCACTCTCGAACGTGATGGTGACCGTGCCGTCTCCAACCTTGGTCCAGTTGCCTG
CACTGTTGTTGAAAGCCTTCTTTACGGTCTTTAGGCCCAGCGCTTCTTCGGCAGTACCGTCGTCGATTTCTCCGATGAACTGCGTCGGTCCGCAAATGGT
CTGAAAGAATTCGGAAATCGCGCCACCGATGTTCTTCCTCTCCCAAACCGCGTAAAACGTCGCGACCTTGTCAGCAATTTTGTAAGCGTACTGCGCGGCC
GTTAAGAGCGTGCCGTTGGTACTCGTTCCCGAGCTGATCAGGTCGTTCACAACTGCGCCAATCCCCTTGCGAAGCGTATCCCGAGTTTTATACGCTGTAG
CTTTGTCCGACTCAGCGATGAGTTCTTCCATGCAGTTGTTCGTCACGGTAGGAATGTCATACAGCGCGAGGCTCGACTTGCTCATTGCGACGCGGATGTC
ATCCTCGGAGATGCTCGGGTTCTGGCGACGCAATTCAGCTACGGTCATCCAAGTACGATCCAGCAAACGCTTCATGTCGTAGCCGCAAGTGTTATTGGCC
TTCAGCGCCGACTTCAGAGACGTGATATCCGTGTCTTTTAACGAGCTGATAGACTCGCCCAGCGTGATGTTCTTCATGAAAGTCGTGAACGAAGCCCAGC
TGGACACGATAGCGGCGCCATTAGCCAGGATCTCCTTCAAAGCGAGCTCAGCGGTGTTCAGAACTCTGTCAGCGAACTTGAGTTGCTCGTCCACCTTGAT
TCCTAAGCATGCAGCGATCGTGATTGGCACGTCAAAAACCACGTTGTCGGTCTGGTAGAGCATCGTCAGCAGCTTGTCCTGGGCGGTCTGGGGGTCCGAC
ACTTCAACGGTGCGGATGTACTTGGACAGGGTCTTGACCAACCCCATCATCTCCTTGCCACACTTGAACGCAATCTGAATGCCCTTTGCCATGAGCTTGA
ACTCGCCGTACATGTTGTAACTCGCCACAGAGAAGACGGCCTGGGCAACGGATGCCACCTTGCTCACAACCTCGAGTGCGCAGTCGTCGTTCTGTCGAAT
GCACTCAACTCCACACTGCACGGGGTACGAGTAGGGGCACTGAGCCCAACACGTTCCAAGCTTGCTGTTGAACCCCAAGGGACACGTCTTCGCGATGTGA
GACTCGCGGTAGCATGCCGTGTCGGCCGCGGTGCCGAGCGCGGAGCCAATCCAGTTCTTGTAAGTGGACTTGATCGTGCTGGTAGCATTGAGAGCGTTGC
CAATGGTGAACCCCACGCTTGTAGATACACTGTCATCATCGCTGTCTGAAGAATCGCTGATGTCGTCTTGGCTGTCCACTGACTCGTCGTCGCTGTCGTC
GTCGATAGCCGATCTGAAAGTGATCGTCGCCTCTGGAACCGTGGCAGTGGCGTTCGCTCTGAAGTTGGCGGCGGCCACAGTAGCCACCGGCGTTGCTGCC
GTGCTTGTGTTGAAAGTGCACGACTGCGCGCCGGTACATGCGCAAAAGACCAACGCATAGACGAAAGCCAATACCAGAACTATCCTGGTCATCCTCGAGC
CTTGCGTGTGGAGGCGCGTAGCTTCGGGCAAAATTAAGAATGAGATTTAACCAAACCGCCAGAACTCCTAGCTAAAATGCCTCTTTTACGAGCGTCCTTG
CCGAGGCCATCTTGCCGCCAAGCGCAGGTGGTGACCGTCTCAACCCCGAAAGATTCGTGCCGGTCGTACAGTAACCACCGCCAGCAGCCGCAACTTCAGT
CTTGTATCGAATCTAGCTTTCCGGCGCAACGACGAATCTGGGTTTGGCAAAGCCGCGACCTGCATCAACACGGAACGGGCGCTGCTCCGGTCGTTGCAGT
CGAAGTTAGTCTTGACCAACACATTCGGAGTTCGCTCCTCTTGGCAGATGGCCAACACAATATCGCACCGCCTCGGGAATTGTGAGTGGGGTTGTCCTCG
GGATTCAGTTGGCTCGCGCTCATGCTTACCGGGAATCTGCAGCCACCGCAGCGCATGACGTGGAGGTTTGCATTGTCCAGAGTTGGGATACCAGGCCGGA
TTGGCACACCATAGACGAGGCCGCTGTCTCGGTTCGAGGTGCGTTTGTAGCGCCGTGCTGAAGCGATTTGCACTGATTGTAGATTCGACGTCGAAGTTGC
A