Description :
From Genome Similarity Track
Location :
Scaffold_61:88038- 90567
Transcript NameFunction/comments
g13906.t1RAW43718.1 hypothetical protein PC110_g142 [Phytophthora cactorum

Sequence
2529 bases(100 bases per row)
AGAAAATACATGAGATTACCAAGCACCTGCTCGTTCTTGGGCACGGAGCGGAGGGTTGCTTTCAGCAATGGCGGCAATAGACCTCTGCTGCTGGCTGCCA
GTCGTGATTGCGACCATAGCCATAGAAAACCGGCAACATCTTGCGCATCGTGTGCGACGTTTTGTGGTCTTTGAAATTGTACACGCGTTGCCACTTACCG
TCGACGTTGGCGTAGCGGTGCGAGATCTCGCAAGCTTGCGCTGCTTTCGAACCAACAACACAGCCATCAAGTTAGTCCAACCGTGCAAAGCGTCCGCGCT
CAAGCAAAGATGCCTACCATTGCACGCGGCGCATAAATCGTAATCGCTGCAGATAGCGCAGTTAAATCGTGGTCCGGTGAAGTCTGTTTCGCCACACGAA
TCGCAGATAAAGCCTAGATGACGACCGTCCATGATGTAGCGTAAGGTAGCAAGCGGATCCTCGTGGCACTTGCGGAACGCACTGCGCACGCGGAATTTTG
GAATGTCCAGCTTCTCGGCCAGGTTTTCAACCAGTTCTAGCGTAGGCGGCGCCAAATCGGTAGGACTGAACAGTTGTCGTGCTTCTGCATAACGCTCGAG
TAGCAGCTCGTACACGGGGCTCAGGGCACTCGCAGGTGGCACTCCGTGGAGACCTTGTGGTCTTACGCAGAATACCACAATATCCGCTTGCTGCAATCCA
GCACTTTGAGCCGGCGCATGGTACGGGATCAATTCAGAGACAACAGTTGGGGCAATTTCTTCTCGGAACATTTCCAGCTGTGCACAGCTCCAACCTGTAT
GACGAGCAACTGCCTCGTACAGCACACTGGGCGCGAGTCGTCCGCTTTCAGACTTGCCTCGGATTGTCGTGCCGTCGGGACACAATGTTTCAAAAACACG
GAACTTGCCGATATAGTCTAGCTGGTTGGCAGGAGCTGGCTGGAGAAGCTTTACAAACACATAGCCTTCAGGGGTCGCCAATAAATCCTTCGCAGTCGCT
TGGGCACCAGGCGGTAGATCAAGCGGGAGATCATTCGTCACAGAATTGTTTTCAACGTATATCTGACAGAACGAATACGCGTCGATGTCAACTCCATCGC
AGAGCAAGTGACCAAAAAGAGGTCGATCTTGCTGGGATTTGTCACAGGCGAGCAGTTTGCGTGGCCGCAGTGCCTGACCTGACACCACTGGCTGGTTAAA
GCACCACACTCGCGTCTTGGCCATCGCTCCTTCTTCACTGTAGTCCCCGAGCACTTCAGGAAACCGGTCGTGTAGTGCGACGAGCAAGTCGCGTAGTGAG
CAGCAGAAAGGCAGCTCCAATTCCGCCACGTTTGTAAAATCTACGAGTCCGAGTTGATGGTGTTCTCGAAGATCGTGCTCAAATATCACGCGAAATGTAA
TGGACATGAGTCGAACCTGAGCAGATACAGTGAGGATATCGGGTTCGGTTTGGCCCTCCGTGGAGTTGGTAAGAAAACCTTGCTGAGGATCACGCAGCGT
CGATAGAGAACCAAGTGAGTGCACCCCCCAGTTGTTGAGGTGTCGGTGAAACTTGTTGTCCGTTAGACACGAGTGCCACTCGAGTCGACGTCTTGGATCT
CGTGCGTTTTCCACCTGCAACGAGAACACAGCGCACGTGAGCCAGTCCGGTGCACGCCGCGATAAATCAGTCAGTACAAGGTACACGCTGAGTACACGGT
CCTTGTACTGAGCCTCGTTTGGGTTTCCATTTGGGAACACCCATAGGCAAAAGCGATGCGCGCCAATGTTGAACGTGTCCGACACCACCTTGTCCACGCT
TCTCATAGCTTCCACGTCCGTAAACTTGGGTATTTTCACGGACATTTCTGCTCTTTGTTCCATGCCGTGTTTTTCCTCATAGCAGCGTCTCCAACAGCCT
CCATACAGCCTCACCAACTAAAAAAGTCACAGGTCACAAAAATATCAATATCTTAGTTCCAGCTCTCTCTGCTTGCACAAAGCTCTCAAAAGACAGCATT
TCACCCGTACATCATAGTCCGGTGCCCCGGGTAGTTGTGGTAGCAGCTGCGTCCTCAGCGTCGGCCACCTTTTCAGGCAGATCCGCTTCCACACTTGTCG
GTCGAACGTGAGCGTCCGGAAGGTTCTGCAGGTCGCGGCGCACGCCAGCAGTGACTGGCCGTCCAGCTGGGCCAGCGCCAGCGCCAGCAGCTCGTCCGGC
AGCGTCTGGATGTCGCTGGAAAGGTCGTCCATGTCCACGTCGTCCAGATCCAGGCTCTCGCTGTCCGTCTCGCCCGCGGAGCCCTCGCTGACTCGGCACT
GAAGCAGCCGCGGGTGCTGCGCGCGTCTGCTGCTCTTGCTGGAGACCGTTCGGGCACCACCGATCCACTGGCGCTTCTTGGGGCTGAGCGCGCGAGCCGA
TGCGACCATCGCAAAGACGCCGGATGAAGACGAATGAGATTCAAGTTTGGATCCAAGAAGAAGCACTTTGATGGAAAACTATGGAAACATATTGAAGTTG
GTGTGGGAGCACATAGAAATGATGTTGGG