Description :
From Genome Similarity Track
Location :
contig_21:88023- 93054
Transcript NameFunction/comments
g3839.t1hypothetical protein

Sequence
5031 bases(100 bases per row)
ACGAGAGAATAGCTGGGCAGTTGTCGTACAGCCAACTGTACATTTAGCTTGCAAGAAAAGCAACAACTCGAAGTATCCACCAGCAGCAGCAAAATCCATC
GCAGCGCTTGTGCCTTTTACCGAGCGATTGTGGAGCAACCAACGAACAGTGTTGAAGTGGCCATTCCGAGCAGCATAGTCCATCGCTGCATGTGTGCAAC
CTTCACTACGGCTTTCATGAAGCCATTTCACCACCGCAAGATGTCCATTCTCGGCTGCCGAGTTCATGACATCCGTTGACCACTCGATGTTTGGCTGATC
GTGCAGCCATTGCAGCATCTCTAGGTTGCCATTGCGAGCTACCATACTCGTAGTGTGGGCTTCGAAGGTCAACTGAGGGTGCTTGTCACGAATCCACTTG
ACGACCTCAAAGTGCCCCATAGTAGCTGCACCCGACAGCGCATACTGTGACAACGTTGGAGCATCATTTTTACCTTCTGCCTGCATCTCCACAGCAAGCG
AATCGAGGAACTCCAGTACGTGCATATGTCCGTTGGTGGCTGCTCTGTCCATGGCAGTGTTGTTGAACCAACTCACGCGAGATGGCTCGATCTCCGGGAA
AAGAGGCGCCATTTCCCCAAACTTTTCAATGAGCCACGTGACCACATGCAGATGTCCCTTTGAAGCAGCGTTGGTCACCATTTCAGATGGCTTGCAAACA
ATGCCAACTTCAGAGAGGTACTGCACGATCTCCAAGTGGCCGCCACGAATTGCACAATCCATTGCGAAGTGTGGATACTGCACAAGTTTACGGTCCAGTA
GCGACCGCACTATGCCAAGATGGCCTTCCCCACAAGCCGCTTGCAGGGCCTCTCTAGCTCCTTTCGTGATCCATTTCCCCACGAGCCACTCGACCAAGTC
CAATCGACCGTTCTTGGCTGCTCCCTCGAGTGCGCGATCTGATCCATCATTGTATCCTTGTTCGAAGATCCACTGCAGAATGTCCATATGACCTCCAGCT
GCAGCGTCATTCATTGTCGGAGGAGGCAGGTGAAGCTCCGGTCTGTAAACATCGTCCAGAAGCCACTGAACCAACGTCAAATCACCCATTGTGACCGCAA
ACTCCATCACTCTGCTCAAGTCTCTTTCAGCATCAGGAATGTTCTCATACAACCATCTTGCAACTAGTCCATGTCCTCCTTCAATTGCATTCTTCACATC
TTCTTCTCCCCAAACGATGATATTCCGCTTCTCTTCTTGGTTGTCATAGTGCAGCAAATGTTGCAAAACCTCCAAGTGTCCGCATCGCGCGGCTGCTTCC
ACAACTTCCACGCCCGCCGTACACCCGAGAAATGATCCAAAAGCCAGCGAATGACCTCTAAATCCCCTCGTTCTGCCGCGGTCCGCAGCGATTCCGTGAA
TTGGTAGCGATTGTAGTGAACGTCCGATCGCAAGTACCAGAACAACGACCAACTCGAGTGGTGTCTGCCGCAGGGTCACTGCTCTCCCAAATACGATCCA
GGAGTCGGACGGACCCAAACTCACATGCCCGATCCAACGAAATCATGCCCGACCGTCCAAATACGACGAGATTAGTGTACCACATGGCCAAAGCTGCCAC
ATCAGGACGCGATTTCAACGCGAGCTGCACCGCCGCCAGCGCAGTTGTCACCATTGCTTCGAGTCAAACGGGGGGATATTGTAAATGTAGCTGGGTAGAG
ATTCCTCCCCGCAGGTGATGGTCCCTCATTCCAGAGACCTTCCAGCTGGCACACTGACCACTTCCAATTTTGGCCTTACAGGAATTTGCGTCAATCTGCA
ACGAGTAAACCCCAATATTCGATGTAAATCGACTAAATACGACATACAAATTGAATGTTTAATCGTCTATATATTTGATATCCCTGTTAAGTCAATCAGT
TGCGGGCGTTGCAGACTAGCGGAGGTCTTTGACCTTTAAGGCGTTTTTCAGGAATGTGTTGCCCCTGCAGTAACACGAGGGCTTGTGCATTATGCTTGAT
TGTAGACGAATTGTCCGCAAGAAGAACATACTGTGCATAGGTTGAAGGCTTGAGCATTATCGTTGCATTCTAAGGTTGAGTCTCGTTTCATCGATCAAGT
GATCCACATTGGGTAGTGCTCTTCCAGCCATGCAAGGAGGTATTGTCCTTGTGCGCTGAATTTCGTTCCCAGAGTGATCCCCTCGGTGCGCTGAGCGCGC
AGAAAGAGAAGCACCTCGAAGCCCCGCAGTAAAATCTATGGGTTCATCCGTACACCCTCGGTGCGGTTGTAGTGCAGCCAGCGAACAACGCCTAGATGGC
CGAAATGCGCGGCATGGTTCATCGCATCCGTCGTACAGCCCTCCACGCGGTTTTCGTGAAGCCATTCATCGTCCAATCAACATCCGTGAGTTCATATAGC
CATTTCATTCCAAGCGGCCACTGAGAGCTGCCATGTTCGTAGTGTATTTCAAATTCACTGGATAGTGGACATAAAGCCACTTGGCGACTTCAAAGCGACC
CAAGGATGCTGCGGTTGAGAACACCTAGTCTGAGCAGATTGGATCCTCTGCCTTCGCCGACTCCACGAGCGAATGCAGAAACTCCAGCACGTGAAGATGA
TCCATACCGGCCGCTTTGTCCATCGCAGTTTGGCTTGAATAGCCGTCATTATCTTCCGATCGATAGTATGGTGGGAAGACCGAGTAGGGCTCATCTCGAT
ACTTCTCGCACAGCCATTTAACAATATCGAGATGGCCATGCGTGGCAGCTTCGTTCATCATGTCGGACGCACCACCGACCATTTGCCTCTCGTTCAAGTA
CTTGACGATATCCAAATGACCTTTACAAATAGTGCTTTTCATCGAGTATAGAGCATATCGCCCCAATCTGCGGTCTAAAAGCCACTGCACCATATCCATC
CGGCCATTCTTCGCTGCTAGTTCGAGCGCATGGTCCGATCCGCCGTCATGTCTTGCTCAAAGATCCATTGCAGGATCTCCTTGTGATCTCCAGCAGCTGC
ATCGTTCATGGCTGGTGGCGGCAACTGTAGCTCCGGTCTATAGACAACATCCAACAGTCAGTGGACCGTCGCCATGTCGACTTTGCGAACTGCAAACTTA
ATCGCCCGACTAAAATCCCGGTCTGCCTCATGCGTATTCTCGAGCAACCAACTGCTTCAATCGCATTGGTAACATCCTCCGACCCCACGAAATCACATTT
TCTTCTTGGTCTTGATCACTTCCACGACGTTCAGACTCCAAAAAAGTACTGCAGGACGTCCAGGCGACCATACTGGGCCGCATCTTCCACGACTTCCACG
GACGCTGTGCATCCCGAGAAATGGCTCAGAATCCACTGCACGATTGCCAAATCCTCGCGTTTTACCGCAGCACATCGAGATTTTTGAATTGGTATCGGTA
ATAGTGAATATCCGTTCGCAAGTAGTGACCGAGTGACCAGCCAGTGCTTTTGAGTCGCTATTCTCACAGATTCGATACAGAAGTCGAATTGGTTCGGAGG
CACAGGCTTGGTCCAGAGGAATCATACCAGATGCATCGAGATACGAAGAAATAGCTCGGGCGACATGACCCAACGCAGCCACAGAGGGATGAGGACGCAA
GGCGAGCGCGACGGCAGATAGTGGAGCTGCTGGCATGAAATCCCACTTGCTGGCGCCATCGCTCTGACGGCGGAAGACACGGTCCTGACGCTAAGCGTCT
ACCTTTTCCTCACGTCCAACCTCAACATGGAAGACACCCAAACACTCTCGGCACGCGCGCTACTGGGACAGCCGTGGGCGCTCAAGCGATCTTCGCGTTG
TTCGTCCGCTGCCAAGAACTGGAACAAAACGTTTGGGTCATGCTTTTCCCCCAAATATCCCGCCGACTCAGTTGGTTTATTTGGGAGGTAGACATCCGAA
CCGTACTTAATATTGGTATGGAATACAAAATCAATATTAAATCATGATATCATCCACTGAAGCACCCATGCTCTAAACCCACCACATCACTGGGTACCGG
ACTACGCTACTCCTAAGGCGTCAAATCTCTTTTATCGCTGTAAGGTAGCAGAAAGCTTGGAGTTCCTGTCGATGCAATTGCATTGGGCTCAGCGTTTGGT
GGCAATAAAGCTGTACGCGACGCCTTTAGTTGCTGTGCTACGGCATCGTGCTGTGCTTCATGGATGCCTGGGTCATGGCATCCAATGCGGCCTCAAAATT
ACTGGGCAACTGAATGCCCGCTACCTAGCGAAGCGAGCCACAGTATTGTACACCTTGCCAGTCTCCACATGTAGCTCCGCGACACAAGGTCTCCGGCACC
GCACTCGGAGTCAAAGCAGCTATGCACGCGCATCATCGCCGGTCGATAGGAAGCCAAAATGTGACAGTCGAAAATGCGACGAGTCGAAGGTGTACCGCGA
AAGGCGTAGACGAACAAAACCTTGTTCGCTTTGTCGGCCTTGCAACCAACAAAGTGCATGTATTTAATACATGCTAGCTACATGAAGTCAGGTGTCGCGC
GACCGCGACGGCCGCAAAATTTGTTGCCCTGACAACAACGGAAACATGCAGACAGCCATCCTTCGGAGCCAGACGGCTCGTTTCTGGTCGATGAATCACT
GGCCGCGCGTTCGGGGATACATGTCCACGCTGGAGTCTTGCGGCAAGACGGAGCGCCGACGTCGATCGCCGTCCAAGCAGCTTCAGAAATGCAAGGACAG
GCGGTCGGCATCCAATCATGTCGAAAGTGTCCTCGCGCGTGCCGGAATACGGACAGATTCAAGCAGGACCGTGCCCCTGTCATACATTTCGCAAGGCTAA
CTTTGCACCGGTATCGTCTAGAGATGAACGTAGACCGAGGCCTGGCCCGTGCGTGCGTGTTGCGCTGAGCTAAGCCAGCCACTCAGCTGGTTCGGCCGTC
TCGACGAAACATAGTTCTGGCCAGCTCTTCCTTCAGCTTCGCATTTCGCAAGTTACCACCAAGGCCCAAAGCCGAAATGGGAGTGCAACCTGAAGTCTTG
CCACTTCGTGTTCAGCGATCACAGCCGCGGC