Description :
From Genome Similarity Track
Location :
Scaffold_15:88021- 91483
Transcript NameFunction/comments
Physo_131251reverse transcriptase

Sequence
3462 bases(100 bases per row)
CTTCCTCTACGCAAGGAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTCGTAGTCAATCCCTCACCTGAGTCTGTTAGACTGTACCTCTGTGAGGATGG
AGCAAGCTGCGTTCGCGAATTTGGCCCCCGGCCAGCAGGAGGTACTAAAAAAGCTTATGTCTCTGTTGGACCCGACGGGCGTGACGCACCTTGCCTCGCA
AGGCCCGGACGCGATCAACGCGCGTCTTGAGGCGTTCTCAAGTTACGAGAATGCTCTGTTGGAGCACATTCAGCAGAGGATGAGCGCGACGGCGCCTGCA
GCGGTGTCGGCCGCGTCGCAAGCCGGATCGACTCGACCCAAGCCACTCATGCTGAGTGTCAAGTTGTTCGAGGGTCTGGAGGGGGAGAATCTCCTGCTCT
GGATCCGCGAGATCGAAATGGCCATGGGCTCTGCCCTGCTTCAATCGGAGCACCAGCGCGTCGCGCTTGCCATCTCTAAGCTCAGCGGAAGAGCTCGTGA
GTGGGCGCTTACCAGCGGGTCGTCGGTAGACCAAGCTTTCCCGACATGGGATGAGCTGAAGCGACAGCTCTCACGAGTGTTATCGCCGCCGAACCACGCA
TACCGCGTGCGGTCCAAGTTCCTGGCTTGCCGTCAGGGGAAAAAGGACTTGGTGGACTACGTCCAGGAGCTACGCACGCTCATTGCCGGCATGTTCGCTG
AACCGCTGCCTGAGTCTGTCACCGTCACGGTGTTTATGGATGGTCTCAGGACCGGAGTGGCTCGCACGGAAGTGTTCAGCAGTCGTCCTACCTCGTTCGA
GGAAGCTGTGGCCGTGGCGTTGAACGCCGAGCACAATTTCAAGTCCGCTCGCGTCGGCTGGAGCGCGCCACAGGCGAGTACGTCGAACGGTCCTGAACCT
ATGGACCTCAGCTACGCTGAAAGTGACGAAGCCGAGCTTCGGGCTGCTGAGCAGCGCCGCGGTATCCGCCGTTGCTATACCTGCGGCAGCACCGAGCACT
TGCGGCCGGGTTGCCCGCTGCGCAAACAGCAATCTGCTCGTTCGAGCGGCCCCGCTTTGAGCCACAAGGCTGGTTCGTCGCGGGGAAACGGCGACTCCCA
GTAGGCCGCCCCGCGCCTACTGGGGAAGAACTAGGTTCTGTAGTGCCTCAGGGAGGGGGAGGACAACGGAGTATAGTCCCGAAGAGAGCCGTACTCTCAA
ACACGGAACGTAAATGCAAGCCGGGCTTGCTGGTCGTCATTACGACTGTGAAGGGCTTCGAGAAGCCGTGGGCGATCTTGATTGATTCGGGGGCGTCCGG
CAATTACGCCAGGCGTTCCTCCATGGAGGGCAGCGAGTTATATGCTGTGGCGCTTCGCGCGCGTTCTCATGACATAGTCACTGTCCGTTTGGCGACGGGC
ACTCGTGTCACGGTGCCCAAGGTCCCCATGGACTTGGGCGTCAAGTTCCTTGACTTTGACAGCACGGAACGCTGTTTGGTCTTGGACCTGGATTCAAGGT
ATGACCTCATCCTTGGCATGGCGTGGCTGGAACGCCATGAGCCTTGGATCGACTGGAGGTCGAAAACATTAGGTGCTACGCACTTCTCTCCTGGTGGGGC
TTTGGCGAGTCATGAACCCACCTCTGCCAGGACACAGAAGCGCTTTTGGCGCGAGCACTGGACCGAGTCGGTCGCTGTGCTGGACATCGGCGTGTCCGAG
TTGGTCGACAACGCCGTTGTTGGAGAAGCACTTCCCGGAGGGGGCGCGACGTCGTATACGTCGGCCGGTACCGAGCACCGCCCGTCGGGCGTTTGTGGGG
CGGCACGTATTCCGCTGGTTCAGGGGCGTTTAACGCCTGGCGACGGTATGTCGCGGCACTCAGAGCTCAGCTCCCCTCGTGCGCGTGGGATGGCACGTAC
TCCATCGACTTTGGGGCGTTCGACGCTCGGCGACAGTTTGTCGCGGCCCGTTGGGCATGGCCCTGCGGGGGACAAGGCGGAGCGTGTCTCGCCTGGTGCT
TTCATGACCAAGGATTGCCGTTTTGGCGATTCCTCGCTGGCGTCCACGATGGACGGAGGCGCGTTGTCGCCTGGATGTGGTGGCGACGCTGCCGCCACGT
CGCCCTCATCCTCTCGGCCTCGGGCGCGGATGAGGAGGAGGAAGAGACGCAGAGCGTCTGCGGCGTCGAGCGTGTCGAGCGATGAAGCTCCACGCGAGTG
CTGCGAGCAGCTATACACGCTCGTAAATGGGCTGACGGGAGATGTCAATGGTGACATCAACCTTGAAGCTCTTCCCTCCGTGAGTGCTCTCCTTGAGCTT
GAGGAGATATCCGTCGCCGAGTTTGGCGAGTCCTTAAAGGTGGGCGATCTAGCCGAAGTGGTCATGATACGACCAGAAGAAGAGTTAAACTCGTCGTCAC
TATTGGACGAAGCGGTCCTGGAGGACACTAAGCAGGCGCTTAATAAACGTAGTGGCTCAGCCATCTTGAAGGATCCGTCAGATCCGTTGTACCCGTTGGT
AGTGGAGTTCGGAGACGTTGTCTCGAAGGACCCGCCTATGGGCCTACCTCCTGATCGAGGCGTTCGTCATGAAATTGACTTGGTTCCGGGAACCAAATAT
TGCGTCACACGCCAGTGGCCACTTCCCAAGGAACAGTGTGACGTCATTGACGCCTTCTTTCGTGCCAAGAACGAGGCAGGACTGGTGCGCGAAAGCAAGT
CCCCGCACTCGACGCCGACATTCTGTGTCAGGAGGCCGAACGGCAAGTGGCGCATTGTGCATGCTTTCAACAAGCTTAACGCGGCCACTATCCCGGCACA
AACGCCGATACCTCGCAATGATGTTCTTCAGAACAACATGGTTGGGTGCACGTTGTACAGCGCTCTCGACTTGGTCGATGGCTACTATCAGCTGCTCATG
AGAGCGAGTGATATCCCTCTCACTGCGGTGAGTACTCCGGGCGGCATGCTCTGGGAGTGGTTGGTTATGCCCCAAGGGCTGTCAAACGCACCGGCAACGT
TTAATCGTCTTGTGACGCAGTTGTTTCGGCCGCATCGCGCATATGCGCAGACGTACTTTGACGACATCTTCGTCCCCAGTCGTGCGGAGCACGGGAAGTC
GGATATGGAGAACCACATCGACCATTTGAAAGCCGTGCTCGAGTGTATGCGAGCGAACAAGCTCTACGCCAATGCCGACAAGTGCATCTTCGGCGCTGAA
GAAATTCCCTTTCTGGGATGCTTCATTGGGAAGCGTGGTCTCCGAGCGGACCCTGCCAAGGTCAAGGCCATTGTGGACTGGCCGGTTCCTGCGAACCCGA
AAGACCTGCGCAAGTGGCTGGGTCTGGCAAACTATTCGCACAAGTACAGCGAGAATTATGCTGAGTTGGCACAGCCATTGTCTAACCTTCTCAAGAAGGA
TGCTGAATGGTGTTGGGATGCCGAGCAGCAAAGCGCTTTTGAAGCAGTCAAGGAAAACCTGC