Description :
From Genome Similarity Track
Location :
Scaffold_616:8801- 10540
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap-pug3_contig_616-abinit-gene-0.31Chromodomain protein

Sequence
1739 bases(100 bases per row)
GGGTGGGCACCTTGTAGAACAGGCGGGTGGTTGTAACGGTGAAAAGCTGCAATCTTGCGGTCATCAGTCACTTGGTCTTCCCATTCCCAAGTGCAGTCAA
CGTAGCTCAAATCGCGCCATTTCACCAAAAACTTCTTGCCTCTTCGCATAACTGGCTGTTGGTCGTCATCTTGCCCTGCGCCGTGATTATTGTAAGGACT
CACTTCTTCAGGCTCTTCAACCTCTTTCATATCCAAAATACGATCCACTTCAAGGTATGCCTCGCTGAAGTATGAGCTGAAATCCTTCTCTTCTCCGACG
ACAACGTTCTCTCGCGCATTTTCCACAAGTCGAGAATTCTTCTGGAGATATCGTCGCATTCGCATAATGGAATGATGCCCAAATTGCTCAATTTGATTGA
CGTTCAGCCAGTTCACGTGAAGATACGACACGCCCTTCCACTTTATCAAAAACTCCATCACAACCTCGTCGTCATCACTGGTCTCCTTGTGGAAACGAAT
GCCAACAATCTTATCGATCTGAGGTCCTTTCGGGGTTTCGTCTTTTGGTTTTGCTTTCACGGCCTTCTCATCCTCACTCAATTCAAAGTCTGCATCATCG
TCGTCACGTACGTAGTTCTTTTTGGCCTTTCCAGCATTTCTGCCTGACCGACGCGTCGGCTTTTGCTCTTTGGGCGGAGCAGCAGCAGCAAAATTTTCAT
CGGAATCACTATCTTCGTCTTCATCGGAGTATTGCTTCTTTTTGCCGCGTCCCTTCTTCGTCTTCTTTTTAGCTGGTTTCGTAACCGTGTGTGCAGCAAA
CGTCTTTCGTTTCTTTGGCTCGGCATTTTGTTGAATATGGCTATGGGCAGTCGATTTCAAAGCACGACTAAGAAGCTCATTCGGGATATTGCCGCCCGTA
GAAGTAAACTTGAATACCATGATTTGTGCACGCAACTGCTCTTTCTGTTCATTTGTGAACGCAACACGAACCGCAGCTCGCTTCACAGGACGCTGGATAG
GTTTGATATCACGTACGTTCGAGGCTGAGACAGGAATACCGGGATGTTGTTGTGTCATTCCAGCGGATGCCGACATGTTCCCCGCTGGGTTCATAAACTT
GATCGCACTATTTCCATACGTTTGATGGATGTAACGATTGTACGCCACTGCTGCCTCTTTCTCTGTAGAGTAGACACCTAAGCGTCGAATACCACCACCG
TCGACATGGAGTTCTGCAGCCCACTGTATCGGCGAAATATATCGAACTCCCATGTGCCACATACCCGAAGTAAACTGCTCCGGGTTATCGAGACTGTTCA
TCGAAGTCCGAAGCCCTTTTCTATAGCCATTGACATCGGAATTGATATTGGACACAAGGCCAGCACCTCCAGGTCGTCGAAGTCGGAGCAGAACTGGACG
CAAGGATTTCAGGCGCGATACCACACGAGCAAAGTCTTCCTGAGACTGGACTAGAAAGCCATCGACGGCAACAAGTTCGTCACCGATACGAATCATTCCG
CTTGCCTCTGCCGGACCCATGATACCACCTTCTGGTCGACGGAAACTAGTAATCGTCACCGATCCCATGCGCACACTCATGTTCATGCACAGCCCGATGG
ACCCTTTCTGCAACAGCACTTCATACTCTTCTTGCTGATATGGGTCCTTCCATCCGTGCGCAACATGTTCATTATTCACGGTCGCTCGTAGTACATCAAC
AGCCATCGCAGTCGCTTGTGCCGGTGTGGATACATTCTT