Description :
From Genome Similarity Track
Location :
Scaffold_78:8800- 16712
Sequence
7912 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTCCTTCCTCCTAATCCACCCTTCCCCTGTGGATCCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAG
CGATCCTCCTCCTCCTGGCCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGATCAACTCACATCAACGGATCCCCTTCCTACTCTTCT
TCATGAGACCGCATCACGCCGAATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATATGCCTCGTCTACCCAAC
TGGGTTCGTCATATCCACGCCAATACACTAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTCTCGACTTC
GAACTCGTCGGCTTCGAGATCCATATTCCAACTATCTTCCGGTAGGGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGACCTGCG
GCCGATCCGGGTATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCGTGTTC
TCGAATCTTCTTGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTACCCTTCTTTCACCCGATCCAAATAAAGCCACACCTGCGTT
CCCACTTGGATTTGATGTGGACGGGCGTCTTCATTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCT
GGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTGGGATC
CCACCCATGTACCAAGTAAAATGGGGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTC
TGATCCAAATCCTGGACGTACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTC
GCTGTCGCTGCCCCAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCCCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCTTTG
GAAAACGCACTCCTTATACGATTCAGCAATGGTCTGCGCAGTTCTAGACGCACTAGCTTTGGCTACCACGTATCCGGTAAACAGGTCCACCCAAATCAAC
AATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGACATTCCCAGGTGACCCCC
CTTCGATTGTGGGCCTGCCCTTGCCTGTCTCACAATCCACACATTCCCCGACATACCGTTGTACGCTCTTGAATAGTCCCCTCCAGTGAAAACATTCCCG
GATCCGTTGGTAGGTCCGACCAATACCCTGATGTCCGCCTTCCAAGCTAGCGTGATAGTGGTGTAGGACATCCTGTTGTAAGGTTTCCGGCATCACCAGT
CTCATCAATCCATCCCGATCCTCGTTGACTCTCTTCGTAGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACCGCGTAATCCGTAGCGATAATCCTGTA
GGATTTGGCATCTTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCTAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGC
TCGATGCGGACTCTCTTCACAAATGTTTCCTCGAGAATTTGGGGGTTGGATCCAATCCTTCCTCTGGACCTAGTGACGACCATCACCTGGACTGTCCTTT
TCCTGGATCCCACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAA
AGCGGCGCTGGCCAAGCTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATCACTTTCTGC
CGTAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCCCCACAAATCACCAGCCTTTTCGGATCTT
GTCCCTTTAGTAGATCCAAACCCAGCAGTAGCCCGTTATACTCCGCTTCGTTGACGGTGAGGCCTTCCGCATAAGTGGATCTGGCCCGTACAGCTTCCCA
TCCAGGTAGTCTCCACAGTATCGCACTGTACGCCCCGCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCGTCTACCTGT
ACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCCTAGTCAGCGCCTCATTCATCTTAGCTCGAGGAGTGATGCTCGCGG
CCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGCGAGAGTAAAGCTGCCCACTGCCCCAAACGTCCTTGTAA
CCCGGCCGACCTGAACAGCCAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGATCCAACACGCGCAGG
AGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTT
GTACCAGAGCTGCTGAGACTGCCCAGTCGCTGGCATAAACTATTACCGTAGGTTGACGTTCTGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCT
GTTCCTCAGTTCCACGAATGCGTGTTGAGATCGGATCCACCGAGATTCTGTCTTTTCCATGTTCTGATCCGTCGTGTCTATCCAGACTGGATCCTCTCTC
CGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTT
GTTGAATTTTTATCCGGACAGCTGGAGTGGTCATCGCAGCAAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAA
CCGACTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCCCGTAACGACTGCGGGAAGGGCAAATCGGCTAACGAAGACAGGTCCTTAGGATTCGCC
TCCAATCCCTCCTTGGAAACTCGATGGCCTAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACG
CCTCCAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTTCGCCGGGATTAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACGGACGGGGT
TCCAGGATCCCCTGGCTCTCCTGCCTCAAATGGATCTACTTCCGTATGATCTTCCCCGGATTCACCCCTTTTGGGTTCCGGTATTCGGGTGAATCCATAG
AGGGCGTTATCGATTAGACGTTGGTAGATCTGGGGCGCGTTCTTCAATCCAAACGGCATCCGGTTCCACTCGAACAGTCCAAACGGTGTGATGAATGCGG
ATATCGCGCGAGCTCGATCCGTCATAGTAACTACCCAAAACCCGCTGGCCATGTCAAGAGAGCAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTC
ATTGATTAGAGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATG
ATTACCACTGGGGATGCCCACGGGGACGTTGAGAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATAGTTTTTCTCGGAACTGAGGCG
CCACCTTCCGCACCCTCTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAAT
CAGCAGATGTCGGCTCTCCCAGATTTTCTGACGCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCT
TCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGCTCATCTTCCG
TCTTCGTAGGGTCCACCATTGGATCCAAACACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGGATCAGATACCCTGGTATCAGGGAAACC
ACCAGTTGGATCTAGTCGGTCCTCTAACGAGCTTAAACCCGACGGTTCTGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAAT
GGAAAGCTTGGATCCACTTGTGGATCAGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGAC
TCTGGGGATCGTCCTCCGTCGTGGATCCAACCTCCATAGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCG
ATCCACCAAGGGGCCAGTTGGCTCCGCTGGGAGCTCCACCTCTGCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAG
CGGCTGGATCCCACTGACACATATCCAGGTCGTCTAGGGATACCGTCCTTCGCTAGCCATCGCCCGATCTCCTCATAATGGTCCAGTAATAATCTCTTGT
CGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGCCCCTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTAAACCACAGTCTCTCATGTTC
CACCCACTTCAGCCGATCTGGCAGTTCCCAGGTTTCTCCGGGCTCGATCCAGGTCGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGT
CGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCACGAAATCCATCCCGA
GGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACG
GTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCTATCCACTTGGCACCCAACCATACGAGCAAAGGCGGTATCTAGTATAGACACCTCG
GCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATC
CACGGGACTCCCCGGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACC
CTTGGTAGGCTCAAACCATCGACCATGTTGTCGCTTCTCCCAGTAACCGCGCGCTTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGAACTGGCA
AACTCATCCACTTGGCGCAAACTAGAGATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGACCTGCTACCTGGATCTA
GCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATCAAACCCGGCGAGCGTCCTAGCTTAACATCTTCTCGGCCA
CTTCTAGCAACATCCCTCTAGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCTGGCCACAACCACG
ACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCG
CACTGCGAGCACCTGATTTGCGCTGTCCCGTCCATGAGATCTCAGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCACCAGTGCGAGAGTTGTCTC
CAGTCTTCGCCGTACGATCGTTGGGCGTAGTGAGACAGACTCGGCGGTAATCTTCTGGATCGGAGTCCGAACCATCGGATCCCGATTCAGTTCCTGAGTC
GGGCGCCATGACTTGGTGGACACGTCGAACTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGGTACTTGCCGGATCCGGCAGCCGCCTTCTTCTGGCGGTGT
TTCGCGCGATCCACAGCCCGCAGTACTTCTTCAAGCTCATCGGCGTCTGGAAGACGTAGCAGAGTCAGCCTGTCGGCCAGATCACGTCTCCCATCGTCTC
GATGAAATGATCCACGTGTTTCCGCAGTACCCTTGGATCCCCCATCCCTTGATCTTCAACTTGGCCCGTAGACCGGCCCACATTTAGTCGATGTAGGTAT
TCTAGCGGGGATTCATCCGATCTGCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAAT
CTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAAACACTTCTCAGCATCCGA
CGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATG
GCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTG
GGTCGAACTCATCATGGGAGTTGTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCGCTCT
CATACCCTGTTCGGCCAGAAAACGACTCATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACT
GGCGAGACCGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAGTCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCA
GATCACGCGTAGGGCCTACTGGATCCCGAGCCTTCACGTTCACAGGGGCTTCCTGACCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCGGGAGGG
TCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGGACTCAGCTTGGCTGACCCTCGGCGACGAC
ACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGA
TATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCCTTGAGTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGC
TCTCACCGGTTCCCTTGGATCTTCGATCTGACGTGAATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACA
AACTCGAGATCCTTGTCTGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCG
TCTTCTTTCTCG