Description :
From Genome Similarity Track
Location :
Scaffold_1774:880- 6436
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1774-fgenesh-gene-0.0T-complex protein 1 subunit zeta
Pytiw_DAOMBR242034maker-piw_contig_1774-fgenesh-gene-0.2Vesicle transport V-snare protein vti1a
Pytiw_DAOMBR242034maker-piw_contig_1774-snap-gene-0.5T-complex protein 1 subunit zeta
Pytiw_DAOMBR242034maker-piw_contig_1774-fgenesh-gene-0.3FAD synthetase

Sequence
5556 bases(100 bases per row)
ACGAAGCGAGCACCACCACCACAGCACCTCCTTCCTCCACGAGCAGGCGACAAGCATGAGCAACCGCGGCAACATGGAGACCGTGAGCAAGTCGCAGGCG
CTGCTCGTCAACGTGAGCGCAGCCAAGGGCCTCCAGGGCGTCCTGAAGTCCAACTTGGGTGCGTATTTATCCAAGGGCTCTTGTTATCATTATGCGAGCG
AGCGATCTTTCGCAGAGCTCTCTCTCTCTGTAGGAATTAAAACGCGTGCAAGGAGACTGACTGTGTGTGTGGTGCGTGTGTACATACAGGCCCCCGCGGC
ACGCTCAAGATGCTGGTCGGCGGCGCCGGACAGATCAAACTCACCAAGGACGGCAACGTGCTGCTGCACGAGATGCAGATCCAGCACCCGACGGCGGCGC
TGATCGCGCGCGCCGCCACTGCGCAGGACGACATTACGGTAAGATACTAGTGTCCCATGTATTATATTTACGATACGATGCTGGATACGGAGCTGATGTT
TGGATTTCAATGGACACGATGCCACATGCAGGGCGACGGCACGACGTCGACGGTGCTCTTCATCGGCGAGCTGCTCAAGCAGTCGGAACGCTTCCTGGCC
GACGGCCTGCACCCGCGCATCCTCATGGAGGGCTTTGAGCTCGCCAAGGACGAGGTGCTGCGCGTGCTCGAGTCGCTCAAGGTCTCCAACAAGGACATCC
TGAAGGACCGCGAGCTGCTCTGCTCGGTCGCGCGCACGTCGCTGCGCACCAAACTCGACCAGAAGGTACGTTGGATGATTCATCCAACAATATAAGCATG
TGTTGTTATGCTGACTTGTGTGTATGTGGTGATAACAAACAGCTCGCCGACCAGTTGACCGAGATCGTCACGGACGCCGTGCTGACCATCGCGCAGCCTG
GCCGCCCAGTCGACCTGCACATGATTGAGATCATGCACGTGCGTACACATTATACATATCTGATCTTATGTAGCGGTAGTCCATGAACTGATCTTTGTAA
CCTCTGTACAACTATAGATGATGCACCAGAGCAGCAGCGACTCGCGCCTGATCAAGGGCATCGTGATGGACCACGGCTCGCGCCACCCGGACATGCCGAC
GTCGCTCGAGAACTGCTTCATCATGACGTGCAACGTGTCGCTTGAGTACGAGAAGAGCGAGGTGAACTCGGGCTTTTTCTACAACAGCGCCGAGCAGCGC
GAGAAGATGGTCGAGGCCGAGCGCAAGTTCACGGACGACAAGGTCAAGCAGATCATCGAGCTCAAGCGCGAGGTGTGCACGGACGAGAACAAGAAGACGT
TCGTGATCATCAACCAGAAGGGCATCGACCCGCTGTCGCTCGACATGCTCGCCAAGGAGGGCATCCTCGCGCTGCGCCGCGCCAAGCGCCGTAACATGGA
GCGCCTCACGCTCGCCTGCGGCGGCATGCCGATCAACTCGACCGAGGACATGGACGAGTCCATGCTCGGGTACGCCGGCAAGGTCTACGAGCAAACGCTG
GGCGAGGAGCGCTACACGTTTGTCGAGGACGTGCAGCACCCGCAGTCGTGCTCGATCCTGATCAAGGGCCCGAACGAGCACACGATCGCGCAGATCAAGG
ACGCGATCCGCGACGGCATCCGCGCCGTGAACAACGCGATCGAGGACCAGGGTGTCGTCCCCGGTGCCGCGGCCTTTGAGCTCGTGGCCCACGAGGCGCT
CAACAAGTACAAGGGCACGGTCAAGGGCCGCGCGAAGCTCGGCGTCCAGGCCTTCGCCGACGCGTTGCTCGTGATCCCCAAGGTGCTCGCCGAGAACTCG
GGCCTGGACGTCCAGGACACGCTCATCGCGGTCCAGGAGGAGCACGCGAACTCGGGCGAGGCCGTGGGCATCGACCTCTTCACGGGCGAGCCGATGCTGC
CGGCTCAGGAGGGCATCTGGGACAACTACCGCGTCAAGCGCCAGTTCATCCACCTCGCCACGACGCTCGCGTCGCAGCTGCTGCTCGTGGACGAAGTCAT
GCGCGCCGGCAAGCAGATGGGCGGCGGCGGCGGCATGCAGCCAGAGGAGTAAGGAAGAACACACACACAACACGCAGAACGAAAAGCCTAGTCAGTCGTC
ATTAGTATATTTCCTTTTTCCCTCTTCTCCTTCGTCAGCATACAATACAGAGCAGAAACAAAGCCAAGAAACGCATGGAGATGTACTAAGAGAAGGACAA
GTGACTCACTGGTTGTATTATTATGGACGATTGACTCAACGGCTGCGCAGGAAGAGCAGGTAGAACACGACGATGTCGGTGATCGCCAGGCAGATAATGA
TAAACCACAGGAAGATCTGCATTAACACACACATGCACACATGGTCAGCTATTGAAAACCACACCAGGCACAATGTTAAAACGGTTGGAGCAGGCAGTAC
TGTACCTTGCGGCGCAAGGAGCGGTCCGCGATCTTCTGCAGCAGCGAGCGCACCTCGCCCGTGATGCTCGACGTCTCGCTGACCATGCCCTTCATGTCCT
GCAGCTGTGAGCGCTGCAGCTCCAGGTCGACGAGCACGTTGCGCGCCACTTCCTCCGACTCGTACATGGTCTTCTTCGACTGCTCGATCTTGTCTGACGT
CCGCAGCAGCGCCTGTACGCTCTATTAAAATGTTGCCCATACATCAAAGCCACACCAGTGAGCACGCATATACATATACACATCACCACACGTACTGCTC
TCATGCATGCCGTACCTGGTCGGACGAAAACGTGCTGTAGTTGCTCATGGTTGGATTCACGTCGCCGCCACCGGAAGCCGCCGCCGCGGACGACGACGTG
GGGCTGCGGTTTTTGAGATTCCGCCCATTCGTGCTGTAGTTTCTGCTGCCGGCGTCGCTCACGTGCAGGTCGCGAAAACTCCCCTCCATCGCGTTCTTCT
TCGGGCGCTCCACACGCCGACGGCCTTCCTGCGGATCTTGTTGCTCTTTGGCTGACCTTCCACCCACGCCACATGACACAAAAAGGAATGAATCAGGCAG
CCTCAAATGAGGTGGGTCACCTTATTCATTTAGTCCTACCTCGCTAAACTAAGGTGGGACACACTAATGTATGGTATTCTAACACTGATATAGTGTGAAA
TACACTAATTTTCTTAATCGTGTCTTCTGAGCAAACCAAATACTGGGCAAAAAACGATGAACCTCGGCAAGACAAACTACCGCGTCGGCGGCACGCGCGG
CGGCGCCGACCGTACGTACCGCAGCCTGCTGTGGCTCTCGCTATGTATATGATGTATAATGCGGATCTTGCCTATCCACACATGCTCATGTTTTTTTAAT
TCCGCGTGCGTGTACTTTGTATTCTGTTGATGCGTCAGAATTCAAGTGGGACGATGTGAAGAACGACAAGTACCGGGAGAACTACCTCGGTCACTCGGTG
AACGCGCCCGTGGGGCGCTGGCAAAAGGGAAAGGACTTGACGTGGTACGCCAAGGCGAGCAAGGAGCAGCGCGCGCTCGAGCTCAAGCAGGAGCTGCTAC
TCGCCAAGCAGCGCGACGAGGACCTCATGAACCAGGCGCTGTACGAAAGAAATGCAGTCCATGATACCGGTATTGGCAATTAGTTAGAAAGCTGACTTGA
TTATTGTATGCTATTGTGCAGAGGACTTGCACCACGCCGTCGTGAAGAGCCAACTGGGGAGCTCGATGCGTCCGAGATGAAGGAGCTGCTGAAGCGCGGC
GAGTCGGAGCGTGATGGAACGATGACTGAGCGCATCGAGGGTCTTGGCGCTGCACCTGTGACAGCTTCAGGGGTGGACACTGGTCCGAAGAAGACGTTGG
CCGAGCGCTACAAGGAACAGCTCGAGTCTGGGAAGGCGGACACGACGTTTGCGCTCCCAGGCACGATCTCGTCCAACGGTGCGGACGCATCGAGTGGCTC
ACGAAGCGAGACGAAAGAGGAGCGAAAAGCTCGAAAGGCCGTGAAGAAGCTCAAGCGCAAGGAGGAGAAGAAGGCCAAGAAGGAACGCAAGCGAGAGCGC
AAGGAGCAGTCCAGAGCCTCGTCGTCGACTCGCCGTCACAGGCGCGACAGTGATAGCGAAAGCGATGATAATGATGATGTTGGGAAACGAGGGCGCTCTC
CAGAGTCTCGCAGCCGGTCTCGCTCACCGGCGCATCTTAGAGAGCGCCGCCGCGGCTCGTCGTCTCGCTCAGTATCGACAAGAGACCACAAGGTAGCGCG
CCCTCGATCGCGATCGGCGTCGAGAGAGCGAGGAAGGGCACGCGATGGCAGAGATTGCCACGAGACCATCCGATCGCATGCCTCACGCAGAGATGGAGAT
CGTCGAGACCGCTCACGGTCTCCCAGCCGCCGCCGCCATCGATCGCGCTCGTACTCGCCTGCGCGAGGTGGTGGCGGCAGTAGCAGATACCGACGACGCG
AGTCACGTTCACGATCGCGATCCCATCGCCGCCGCTAACCGCCTCTAGTAGATATGGATTTACTGGACAGAAGCTCACGAATACAATCTCAATGTGCCTT
TAGCATGCTTGTGTGTATATTTTGTCTCCTGTCGTCTATGTGTATGTGTGGAATTCTGTATGTGGGTGTGGGTGCATGAGGATCCCTCGTCTACTCTGTT
GAGTGAAATCTACTCGGACTTGGAGGACGTGTGCGCCTTCTTCTGTCGTCCACAGCGCTCCGAGCTGCCGTCTCTGAGCTCGTATGCTGGCAGATAGTGG
CCTTCCTTGCTGTTCTCGCCAGGCTTCTGCCACAGCTCGGGGTTCTGCACCGTATCGTAGATGTTGCCCAGCGACGTGTAGCTATTCAACAACCACAGAA
AACGAAGAGCTCATTTTAGTCGACACGTCATAAACGACAGACCACCATATATAACAACCCATATAGTATACAAGAACGCACCCGTGGTCGTACAGGTGGC
AGTATTCGAGCTGGCACTCGCGCAGGAAGCTCCAGACGTCGGCGTACGTCCAGCGCAGGATCGGGTTGACGCGCAGGAACGCGGGCCACCCGGACGTGCT
CGGCGAGTAGTGCTCTAGATCCTCTGTGTGCGGGTCGCCACCGCGCACGCCCATGTAGATGCCCTTGATGTGCAGCTTGTCCAAAATGTCCTTGACGCCC
TCGACGAACGAACATTTGTACACGTGGCAGCTCAGCGAGAATTTCTCGACGCACACCTCGATGAAGTCGCGCACCTCGGGGAATTGGTCGTGCGAGTCAA
AGTACATGACCGGCACGCGCTTGATGAGCTGCTGCACGCGCGCCTCGAGCTCGTCCTCGCTCAGCAGGTCGGCGCTCACGAAGCTCTGGCGCGGCGACGT
GACGGTCTTGGACGCGCGCGTCGCCTGCTCGTCCTCGAGGCGCTTCTGGTCCGCGAGCTGTGCTTCCTCGAGCACGCGCTTGGCGATCACGATGCGCAGC
AGGTGAAGCACGACGGTCGAGTCCTTGCCGCCGTTGAAGCTGAAGCACACGCCCTCGAGGTCAAAGATGTCGAGCGCGCGGTGGATCACGTCGAGTGCCT
TCTGCAGCCGCGCGCGCGTGGGCACGTCCGCCGCCGCGTAGAACGCGTCGAAGCGC