Description :
From Genome Similarity Track
Location :
Scaffold_758:880- 3026
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_758-fgenesh-gene-0.0Leucine rich repeat containing 45

Sequence
2146 bases(100 bases per row)
CATTCTCGACTTTAGCAATTCGTACTACGGAGACGACAAGTGCGCGGAGATCGTCGAACATGCGCGCAACTCGCCGTTCCCGACGTCGCTCGACCTCCGC
GGAAATCGGTTCGAGGCCCTGGGTGCGAAAGCGCTCGCGGATCTGCTGCGTGGACAGCACAACATCGTGTCGATGAGCCTCGAGTGGAACAACGTTGGGC
TGCTCGACCAGGGAATCGAAGCGCTCGCATTGGCTCTGGAGGTTGACTCGCGACTCTTGGTGCTCGACTTGCGCAACAACAACGTCGGAGCCGAAGGCGC
AAAGGCACTCGCAAAGGCTCTCGCGAGGAACCGCACGCTCAAGCAGCTGGATCTACGATGGAACGATATCGGAAACGCTGGTGTGTTGGCGTTCCGCGAG
GCGCTGCAGAGCAACCACACGCTCGTCAAGCTGGAGCTCATGGGAAACAACAGCAACCTCAAGCATGTCGAGGAGATCGACAAACTCCTGGCACGCAACC
GCTCTTTCCAGGAACAGCAGCCGATCGCACCTTCATCGCCCGAGAAGACCGCGGCGCGCGACACAATTCGAGACGATGAAATCAAGACGGAGGCGGTGAA
ACACGCCGATGACCAGTTGCTGCTGCAGGTGCTGGCTGAGAAGGAGAGCTTTGAGTCCGACTTGATGCTCGTGCGGAAGGAGGCACAACAACTGGTATGT
GAGATGAATTTGTTCGTGTGCATGGCTGTCAGAACTCTTACAACAATATCGCTGGATGTGACCACGCAGAATGGAAAGATCGAGGAGAGCGAACTGCAGA
TTCAGCTCCTTCGAAAAGATGCGGAGACGCTGAAAGAGGAGCGAAATCGGTACCAACAGCGCGAATTGGATGCAAAGCGAGAAGTGCATGAGCTCAAGAT
GCAGCTGGACGAGCTGGAGAACAAGCGCAAGATGGAGTTCGAAGAGTATCGCTCTGCGAGAACTGCGCTGGAGCGGGATGCCAGCGTCCTGCGAGAGAAG
ATGAGCCACTTGGAGTCACTGCAGAGCAAGAGCATGGAGCAGAAGAGCAAGCAGATCGCGCAGCTGGAGGATCAGAAGTACAGCCAAGACGCGGAAGTTC
ACAAGCTCACGCTGAGCATCCGGTATGTTTGGTTAATGCTCACAGATTGCAGCTGTCACGAGGTGCTAAGTTGATATACTGACTGCATACTGCTTCTACT
ACGCAGAGCACTGGAAGATGAAGTGGACAAGTGTCAGAAGCAGTTGCTTGATGCACAAAAGGACTATGAAAAGAGAGAAGAGAAGCTAGGTTCCTCCCAC
AAAAACACTGTTGCAACCCTGCAGCGGCACCACGAGCTGGAAGTGAGCTCGCTTTCCAGCCAACTCAGTCACATGACCATCCAGTTCGAGGATTCTCAGC
TCAATGCCTCCACTTTGAAGGACAAGGCGGAAAATCTGCAGGCAAGTGTTCTCCAGTCCAAGGTCAGCCACGAACGCGAGATCACGGAGCTGAAGAAGCA
GTGGGAAATCGGCATTCAAGAACGTATCCAGCGGTCTGTCGGGTCCATCGAAGCTCAAGTCGAGGAAGTCAAGAAAGGTCGCCTGCATCTCGAGCGAGAG
GTCGAGAAGAACATGGAGACAATTTTGCGACTCCGACAAGAAAATATCTCGCTCCAGCAAACCTGTGACGAGAAGCAGCGAGGCTTTCATGAAGAACTTG
ACAAACAGTACAAGGAAATCCAGGAGAAGCACGATTTGTGGACAGCTGCTGCGAAGGAGAAGGTGAGGTGCGAGGAGAAATTCGAGGCCCACGCTCGGCG
GCTTGAGGAGCAGGACGCTCGTCACATCCGGATGAAAGACACGTACGAAGAACGCATCCATGTAAGTGCTCAGTGCGCTTGTTGTCTGTGAAGAGGGACT
GGTCACTGATTTTTAACTCGTGCTGTAGGAAATGTCGGAGGCGTCAAAGGTTCACAATCAAGAAGCGAAACACATGCTCAAGCAGAAAGTGGACGCTATC
ACTGTTCTGGAAAGCCAAGTGCTCCGACTAGAGCGAGATCTGTCAAAGCAAACCCACGAACACGAGAAGAAGATCGACCAGTTTGCCGAGTCGATCAGCT
CGTTCGTTCAAGAGCAGATCGCTGCGGAACACGAGCGACGGAAAGA