Description :
From Genome Similarity Track
Location :
Scaffold_2116:88- 3165
Sequence
3077 bases(100 bases per row)
GATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAGTGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCTGTGAGAAGTGTG
GCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGTGTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGCCCGATGGAAGAATTCTACAACCA
GATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGATGTTGCCGGAAGTGGCAGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTTGAATCCGGTAC
GAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCT
ACATGAAGTGTCAGTTGCCAGGGTCTCTAGTTTGCGCCAAGTGGACGAGTTTTCCAGATCCAAAGTCTCTTCAACCCTGGATCTACAAAAGGGAGAGGCA
CGTGGTTACTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCTAAGGTCTGTCTGGTCACTGGATCCT
GTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGT
AGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTTCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAA
GTGGATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTATACCGTACAAACGGGAGAACGCGAATTAAGATCACGCTGGCAGGTTGTTTGG
TGTATTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCAGCTGGAGTGAGGTTGGATCTGGCGGA
TGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACCACC
TGGATCGAGCCCGGGGAAACTTGGGAGCTGTCAGACCGGTTGAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTACCTACAA
ATGGGTACCTACCGTAGTCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAAGAGATC
GGACGATGGTTGGCGAAGGACCGTATTCCTAGGCGACCTGGATATGTGTCAGTGGGATCCCGCCGCTACAGAGAATGGCAGAATCTGGTGTACGAGGCGA
CTACCGAGATCGAATCTCTCGGAGAGGTGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCA
GAGAGATCGACGGGTTGAGATCCAAGCAATGGAGGTTGGATCCACGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGACGAA
GGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCCGATCCACAAGTGGATCCAAGCTTTCCACTGGATAAAGTGCCTGGATCCCTATCGAGAGTGG
CAACGCTAGACAAACCTGAACCGTCGGGTTTAGACTCGTTAGAGGACCGGCTGGATCCGACAGGTGACTTCTCCAGTACCAGGATACCCGACCCCACGAA
GACAGAAGGGATGACGGTCGAAGGAGAGTCGCGGTGCCTGGATCCAAGGGTGGATCAGACAAAGACCGAAGATGAACAAGTCTGCTACCGTGAAGGCGGG
GATCTACACGCCGAGGATCTGGGAGAAGGTATGGCGGTAATCCCGGAGGTACCACTGACCACCGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAG
GGGCGAACGAACCCACTGAAGTGGATCGTCTGCGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATCGGTAAGGGTAATGCGTTACCGCCCGCCGCCCA
CGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAAAAAAACTGTCGGATCTGATT
AAGGGCTTGCTGCAAGCCAGGATCATCAGCTTCTCAACGTCCCCGTGGGCGTCGCCGGTGGTAATCATCATCAAGAAGACGGGGTGTATATACGTCTGTG
CATTGATTACGCGCGTGTTTACACACCCGCCCTCACTGATGTGGTGGTATATCCAATGCCTCTGATCAATGAGCTGTTGGAAGATTTGGATAAAGCACTC
TGGTACTGTTCTCTAGACATGGCCAGTGGTTTCTGGGTGGTTACTATGACGGATCGAGCTCGCGCAATATCCGCATTCATCACACCGTTTGGCCTGTTCG
AGTGGACCCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTCATCGATAACGCCCTCTATGGGTTCACCCGAATACCGGAGCCCGA
AACGGGTGGATCCGGGGAAGGTGACGCAGAAGTGGATCCATTCGAAGCGGGGGAACCAGAATCCTGGGACCGCGTTCTGTGTTGAGGAAGACGAATCTTA
ACTTGCGAGGACATTTATGATCCCGGGCGAATTCTTGAGAATACAGTTGTGGCGAAGAGAGTGACCTTCCTAACGGGAGGCGTGTAACTGAGTGAGAAAT
CTTCTCTTTCCAGCGTGGTTAAGAGACCTTTGGGGGAGATGCGCCAGGGTGAATTACTTGGGCCATCGAGTTTCCAAGGAGGGATTGGAGGCGAATCCTA
AGGACCTGTCTTCATTAGCCGATTTGTCCTTCCCACAGTCGTTACGAGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAAGA
TTACGCCTTGTTTGCCGCGGTGTTGTATGAATTAAGAGAGGTAGATTTTGCTGCGATGACCGCTCCAGCTGTCCGGA