Description :
From Genome Similarity Track
Location :
scaffold_1124:88- 2666
Transcript NameFunction/comments
Pl_101261reverse transcriptase

Sequence
2578 bases(100 bases per row)
ATGAAGAATGGAGTCAGACCCGTCGATGAGTGCTCAGCGTTGTTCAATGCGAACTCGGCCAGCGGTAAGAAGGCACTCCAGCCCGGGAACGATGTCGCGT
AGCTCCGGAGCACGTCTTCAACGACGCGGTTGACACGCTCAGTCTGACCATCCGTCTCCGGATGTCCCGCGGTCGACATCTTCAACTTTGTGCCCAGGCA
TTCGAAGAGCTTTGACCAGAATATGGCTGTGAAGGGGGGGGTCACGGTCGGAGACGATCGATTCAGGCAACCCATGGTGTCTAAACACCGCATCCACGAA
GAGAAAAGCGGTTTCCTCCGCGGTGACGGTGTCGGACACCGGTGTGAGGTGGATCATCTTACTGAACCGGTCCACGAACACGAGGACACCAGTGCGGCCT
TGCTCATCGGGAGGCAGCCCGAAGACAAAGTCCATTGACACCGAGCGCCATGCCTCGGTGGGGATTGGAAGTGGACGCAGCGGAGCTTTCGAGGACGGTG
ATGGTTTCACTCGCTGGCAATTTCGCAAGTGGGTACCCAAGGGGGTACGCACTTGTACAAGTGTGGCCAGTAGAAATCTTGCGCCACCGCTGCGAAAGTC
TTTTCGTGTCCCAAGTGACCTCCGACCGGAGCATCGTAATACTCGTGGATGATCAGCACACGAAGGTCTCCGTCGTTCGGCACCGCGATTCGCGGAGTAT
CGAAGTGGTCAATGGAGTACATCAGCATAGGGTCATCGAGACTATAACGCTCGATGTGACTGCGAATCGAGCGCGATAGAGCCTTCAGTGTCGCATCGCT
GGGTAAGCGAAGGTGTGCCATAATGGCAGCATACTATGCGTCGTGTTCATACGCGGTTGCGATCTCCTCCCGTAGCGACATCGCGGGGGCGACGCTCGTC
AGGCGCAAGTCTGACGCCACACACATCGCGCATGAGTATTCCTCCTCATCGTCAGGTATCTTCCGCCCAAGCCGTTCGCGTGGATCGTAGTCAGGACACC
GAGATAATGCGTCGGCGAGGATGTTGTTCTTGCCGGGCTTGTAGTGCACCACGAAGTTATAATTGGAGAAAAATGACAGCCAACGAGCCATCCGTTGAGA
TAAATGAGGTGATGTCATCGCTGTCCGCAGCGATGCGTGGTCAGTGTAAACCGCAAACGTCTGTTCCCCGAGCAGATAAACCCTGAACTTGACCAATGCG
TAGCGTATGGCAAGGAGCTCCTTGTCGTGCACTGGGTAATTCCTCTCTGCCGGCTTCAACTGGCGGTGTTTGTAACTGACCACTCGCTCTCGGCTCTCCT
CGTCAAACTGCATCAGGGCACACCCGATGGCGAAGGCGCTCGCGTCGCAGACGACGTGGAATAGTTTCGATTCGTCCGCTAGCATCAAGATGGGCGCGGA
CGACAAGCTCCTCCTCATTGAGTCGAAGGCGTCTTGTTGTTCCTGTCGCCACAACCACGTTGTGTCTTTCTTCAGTAGCGACGATAATGGCTTGATCAGC
TTGGCATAGTCCTTCGTGTACTTGTGCAAGTAATTTGCCATGCCTATCCACTGCTGCAACTCGGAGGAACTCGTGGGGGTCGGCCACGGACATATTGACG
CGACTTTCTCGGGGTCAGCACGGACTCCATCCTTGCTCACATAGCAGCCCAACACCGGGATCTCCGGTGCGCAAAACACACATTTCTTCAAGTTTGCGTA
CATCTTGCTGTCTCTCATCACCTAGAATACTTGCCGAAGGTGTTTCAGATGGACTTCCACGGCGCTAAGCTTGCCCTCAGCGCGACTGTGTACGAAAATA
TCATCGAGGTAACTCGGTGCAAAGTCGCGAAGCGGGCGCAGCACGTGGGAGACCATGCGATTAAATGTTGCGGCGCGTTTTTCAGTCCTTGGGGCATTAT
CAACCATTCTCAAAGCATACCGCTCGGCGTGTTCACTGCGGTGCGAGGAATATCGCACTCTCTCATCAGGATCTGGTAGAACTCATCGGTCAGGCCGATG
TCACTGTAGGTCTCGCTGCCCGCCATGGAGTCCAGCACCATGTCCTTTCGTGGGATTGGTGCCTGCGCGGGGATGGTGGCATCGTTCAACTTGTTGAACG
CGTGGACAATGCGCCACCCGTCCGTGGCTTTCTTTACGCAGAAGGTTGGGCTCGAGTGCGGCGATATGCTCTCTCGCACATGTCCTACCTTGCGGTGGCT
CTCGAAGAACTCGTCGATGGCTTGCACTTGGTCCCGCGGGAGCGGCCGCTGTCGAGTGACGCAATACTTCGTACTAGGCACGAGATCAATCCCGTGGCAT
ACTTCGCACTACTGAAGCTCGGCGGGGATCTTGTCGGGGAAAATGTCCGCAAATCGCGGCCCGTCTCGTACACCGGGTTGCCCGACTCTCGCAGGGCGTC
CCAGGATTGCGCTGCAAAGCGCTCCTCGCGCGCCGACTTTGATTCGGCGTTCTTGGGTCGGGACGGCTCACCTCCATCGACTTCAACTGCGTTGAACACT
TCCGACAAACTCGACTCGGTGATTAGACACACCTGCTCGATCTCGTCGGCCTTCAGCGATCGCATGAAGCTCTTCCAG