Description :
From Genome Similarity Track
Location :
Scaffold_3117:88- 2556
Sequence
2468 bases(100 bases per row)
TGCAGCGAGACAGACTCGGCGGTAATCTTCTGGGTCAGAGTCCGAACCGTCGGATCCCGACTCAGTTCCTGAGTCGGGCGCTGTGACTTGGTGGACACGA
CGAGCTGGAGCCGTGGGCGTCGAAGATTTTTGGCGATACTTGCCGGATCCGACCGCCGTCTTCTTCTGGCGGTGCTTCGCGCGATCCACAGCCCGCAGCA
CTTCTTCAAGCTCATCTGCGTCTTGAAGGCGTAACAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCAGCGTCTTGATGAAATGAGCAACATGTTCCCG
TAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGCCGATGAAGATATTCCAGCGGGGATTCGTCCGATCTGCGG
CGAGCATGGTAGTATTGTCGCGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGC
CTAGCTGCCGATACCAATTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTT
GACTTTGCTGATCCATGTCCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATG
GACGATCCCCCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATCCAGATCATCTGGGTCGAACTCATCATGGGAGTTGTCTC
TCTCCACTGACTCCATCTCCACGGCTCGTGCTCCATGTTCGTGAAGCACTTGCGCTTGTGGCACGGGCGTTCTCATACCCTGTTCGGCCAGGAAACGACT
CATCGCAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGTTCCACTGGCGAGACAGGATCCGTGAGGCGGTTA
CCTTGAGCCCGATCTGACGATAACCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGTGTCAGATCACGCGTAGGGCGTACTGGGTCCT
GAGCCTTCGCGTTCACAGGGGCTTCCTGTCCTCGGATCATCGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGA
CGACGTATCTGACTCATCCCCAGCGGCGGATTCGTATTTCGAGGACGCAGCTTGGCTGATCCTCGGTGACGACACTGGATCCATAGTACGCGACCTTTCT
CCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCTTCTGCGTCGAACACACCAGCTA
CGATGCCTGACTCCGTAAGCAGACGTAATAGATCTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCCCACCGGTTCCCTTGGATCTTCGAT
CTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTT
GACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCATCTTTCTTGTTTCTTCGACTAGCG
GGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAGTCTGCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGC
GTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTC
CTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTT
GAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTG
CCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGG
TAGTCGAGATCTGCTCTCTCAGTAACTTCCGAAAAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGAGGTGGAGCACCAGTGGAAAA
TCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTATGGTTGCCTTGC
GGGTGTGTTCTCTTGCCTTTGTGGTTCCTTAGCGTCGTACTTGCCGCATCCTGTGACGGGATCTTGAG