Description :
From Genome Similarity Track
Location :
Scaffold_1102:88- 1941
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_1102-snap-gene-0.4U4/U6.U5 tri-snRNP-associated protein

Sequence
1853 bases(100 bases per row)
CTTACGTTCGTAAATCATGAGGTAGGATTCAGAGACTCCGATCAGCTGCGGCATCGTCTCCTGCACATGAAGGTCTTGGATTTCGTACCACTGCTCGGTc
GCCTACACAACAGCAATGCCCGATCAGCACTCAAGGTGAAAACTCCAGTTTATACTAGAAGAAGcGTACCCGATTCTGGAGATGCACGCGGTAGCTTCCT
TCAGTCAGTGGATTTGCCTTCAGTGCTGCTGTTTCCTTACCCGTCGTGACGGGGCTGTCGTGGCAAAcGTTCGCGATCAAGTTATACTTGGTCGCAGGTA
GAACGACGCGAACGGCCTTGTCTACCAAGTCGGCCTTCTCAACGCAGTCCTTCCACGATGTCTTGTGCTTGATCAAGAGCTCACGCAGCTGTGTAATACT
CATCGCCTTGAGCTCTTCTTCAGAATGCACTTCAGTATCGAACTGCACGTAGTCACGTAGTTCAAGGTTCTTGATCGGGAAGTTGACAATCGTCGGGTTC
TTCTCGACGAAGAAGTTGTTTCGCGTGAACCGCTTGACATGGAAAATGAGGTAAGACGGCAGCGATTTGATGCTGTAtGTCTTtTGAAGCCTCTGGGAGC
CCTGCAGCACATGCTGGAAGCAGACATTTATCAATTACAGCACGGCAGAGAACAGACGAGCATGTTACATACCGTGACGTGCTTACCATCATACTTTTCG
AGAACTGTAAACAGCGGAATCTGGGGAATAATGTTtCCACacTGACAATCCTTGAATAACGGAGTGGACGGGAGATCAAGAGATAACAACCTACGGGTAG
CACAGTCAGATCAACaGTTACAGCACCATTCAACAACATCAGGAGACAACAGGAACTCATCGAGGCACTCACAGAAATGGGGTCTTAGTTGTCTTGGCCA
CGGAAGGAGTGGAAGCCGGCgCATCTTCGCTTTTCTTTTCTTCTTCATCATCTTCATCAACcGTGATTGCTGGTTTTGTGTCATCAGTAGTTTGAACCTC
GACGAGCCCCTGAAAGCACTTGTGAATGACGGAGCTGCCGGGCTTGTGTGACCCGCCAAGTCCCTACACATACATACAACAATCCATTTAGTCGAGCCAC
TACTTGAAATTCATGTAGTGAGTGGCGTACCCGATGCAGCTCGTTCAGTAGCCACGACAGAAACTCCACACTCTCATTCTGTTGCCCGACGTGGAAGCGC
TTCTTGCTGCTCACACTCACTTCCTGCACAAATTCGTGCGGACTGATCGTGTTCTTGAAGTTATGCGGGCTCCACATCTTGCGCACGAGCTCACCAAACC
GAAGCACAAGGTTCGACTTGGTTTTCCCGACCGTGTTCGACGTCAGCAGGAAGTAGTCGCGCAGTGGCGGGACGTGTGCGAGTGCCTGCACGACCACGTT
GATATAATCAGTGTGCTTGAGATTATTtAAGCCGATGAAGCCCGGGAGATAGGAGACACCGAAGGCGTCCTGCGCGAGCAAaCGATTGGCGTCGAGCTTG
GCGACAGCGTCCAGGTGGAAGGTCGGGCGCAGCGCGTTCTTGATGGGCTGCAGCGCCGTGTCCACGACTTCGTAGTTATCCGGCAGACAGTAgaTGCGGT
CATTCTGTAGGTTGATGAACACGTGGTGGCCATTCTGCACCGAGTGCGTGTACGCGTGTGTGCTTTTGCCGCGGCCCTGGAAGAACTTGCCGCACACGAG
GCACGCGTAGACGTTCTGATCCGAgAGGCTGATGGAGCAGACCTtCTCAAAGTCAAAGTCCAGCAGCTGATGGTTGATCGTGTCCAGATACGGGCACTTG
CGACGCTTCGCACCGATGCCCTCGGCCTCTAGCTCATCgtCCGCTGGACGCTT