Description :
From Genome Similarity Track
Location :
Scaffold_5777:88- 1204
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_5777-fgenesh-gene-0.0Myosin

Sequence
1116 bases(100 bases per row)
CGCTGCATCGTGGTGATGGCCACCTTCTGGCGATGGAAGACCATCACGGCCGCAAAGACCTTGACGCGCCGCTGGAGTACCACGAGCGCGAGACGCATCT
CCTGGTACAGCCGCCGCGCCTGCACGCCACGCCAGATGCTCTGGATGAGCGCCGCGAAGTCAAAGAGTTTGGCAGCCTTGGCGTGGTCCAGGCGCTCCAG
CACGCCCTTTTGCAGGTAGATTTTGGTCTTGCCCATCTGGAACTCCTGCGGCGTCTGAAGCTTGAACTGCTTGACGAGCGCCAGGCAGTTCTGCACGGTC
TCGCCGCTCTGCTGTTGCTGCTCAGTGAGGAAAATGTCGAACTCGGTCGCGAAGACCGCGTGCAGCAGTCGGTTCGGGTACCCGGCGCGCGCGATGGAGA
TGGCCTCGATGACGCCGGCGCAGCGCAGCTGGTTCACCACCATGCGCTCGTCGATGAGCGTCGTGCTCTTGACGCTATTGGGCTTGATGCAGCGGATGTA
GTGCACATTGGTGAGGTTGATGTTGGCCATGAGCGTATTGAGCGACAGCTTGAATTGCGTGCCCACAGTCAAAGCCGCGCCCGAGTCCCCGCTGCCGCCG
CCGCCAACACGCTTGCGAGCCATGGGTCGAGGCGATTCGCCATCCTGATCCGCTGCTGCCACCACCGTCGCAGGCTCCTCCTGCTTCACAGCGAAGAGCT
CCTGCAAAAAGGCCTCAGAGCTCGAGCGCATGAGCTCCGAGAGGTCTGGCAGCAGCGCGTCCTTGTGCTTCTCGAGGAAGCCCACAGCCTCGTACTTAAC
GCTGTCGGCGTAGTGGTGGATCGTAAACTGCGTCTTGGAGATGCGCGCAAACTCGATCACGCGCTTGCTCGCGCGGTACTGCGTCTGGAGCTTGGCTACG
AAGCCCTCCTCGCTGCCTTTGGGCCGCACGACCTCCTCGTTGAGCAGTGCGATGACGCCCATCTTGCTCTCGAGCAGCGCCAGCACCTCCTGGTTGTCCG
CGTACTCGATGTGGCCCCACGAGATGTTCTCGCGCGCGTACTCATCGTACACGGACTTGAACACGTCCTGCGTGAACTTCTGCTGCAGCTTCTCGTTCGC
GTAGTTGATGCAGAGC