Description :
From Genome Similarity Track
Location :
Scaffold_933:88- 1107
Sequence
1019 bases(100 bases per row)
ACTACCTTCTTGTATTGAAAGATGATTACTCCCATTAATTTGAGTTGGTGCCATGCGGAATTCCGGACAGTGCGACTGCGGCGCGCGCTATACTGGAGTG
GCATATGCGCTATGGCATGCCGAAGGTACTGATCAGCGACACTGGCAGCCACTTTAAAAACCAAGTCATAAGCGAGATTTGCCGCATCACCAACATGCAG
CAGCAATTTTCGTTGGCATATTGTCCGTGGATTAATGGGTCTGTGGAACGTCTCAATCGTGATATTCTACAAGTATTACGGGTGATTGTACTCGAGTTTC
GGCTGCGCCACGAGCAGTGGCAGCTCGTACTTCCACTTGTACAGGCCAGTCTCAATCACTCACCGGTTCCTTCACGTGCTGGCCATGCTCCGGTCGAGGT
TTTCACTGGCCTCCCGTGCCCGGATCCATTTGCACTAGTCGTTTGCAATGACACTGAGCTGGATGAAGTGCGTGTGATGCATGAGCTCCTATCGGAGGAC
ACTGATACAGCATTGCTTCGACTGCGCGAGCACCTACAGCATATGCATCACGACGTTTTGGACGCCCGTGAAAAGCAAACGTTACTGAACCAACGCCAGC
AGCGAGGGGCTCAGTTGGTCAACTTTGAGATTGGCGATTTTGTCCTTTGGTCTCGGGTGCGTGAGCGTGTCGGACACAACAAATTATGCATTCAGTGGAT
CGGCCCATACCGTGCCACGGGTGCAGGACCGCATTCATTTAAGATTACTCATCTGCTGACGGGTGAAAAGCGCGACGCACATGCATCTCGGCTGAAATTT
TACGCAGACTCATCATTGAACATCACTGAAGAAATCAAGGCTCATATTGCCAATCAGGCAATTCAATTAGCTGTTGAGGCATTAGTTGATCACCGTCGGA
GCCAAGCTTATGGTTTCGAGATTCAGGTTAAGTGAAAGGGCTTTGATGACATTGAAAATTCGTGGGAACCGATAGCCAACATGTTTGACGACATCCCCAT
CAAACTGGAGCAATATATC