Description :
From Genome Similarity Track
Location :
Scaffold_560:8798- 13633
Transcript NameFunction/comments
g12155.t1hypothetical protein

Sequence
4835 bases(100 bases per row)
TTTCGGCGTAGATCGGCTCGACGTGGAGAGGCGTTGGCAAACCACGACGATTTTGACGTGGCCTACGTCCAGGGTCCAGACGTTGTGAATGGGCGCCATC
GGCTTCCTCCCACCACTGTTTGTGAACATTGTGGCGCTTGGAAGTGGCCTGGCGAATCAAAAATGAGCTGTTGTCTGGAAGACAAGGTTCGTCTTCCCCC
TTTACGGCCTGCACCTCCAAGATTGTTGCAACTGTACCGGGATCCAGCGTTTCGACAGCACATACGAGCGTATAACCAAGCTTTTGCGTTCACGTCCATT
GGCGCTTCGTGCTCCAACCGATCCTTCCAGGACGTCAACCAGGATGCAAGCGTAGCGGGACAGAGGGGCGTGTACACGTACCGCATCCAGGGTGCAATGG
GTCACTACTTGGGATCTCTACTCCCCTATATTGATCCCGCCACCGGAGAGCGCACGGATCCTAAGTTCGCGCAGATCTATATTGTGGACCCGGACATGCA
GCAGCGCGCCCAACGCCGCAGAGGAATTTTTGCTGACTTGGATCCTGTGGCGTTGATGGACATTGAGCAAATGATGGAGCAGCACAACCCATTCGCTCAG
CAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGATATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACAT
ACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTGGATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCT
TCTGCGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTCAGTACCCTCTTCTGCTTCCGTATGGGGAGCTGGGTTGGACCTACACAGACACATACGCG
AACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTTCCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAG
GCGGCCGTCTCTTTCAGCAGTGGTGTGTTGACCAACGCGCTAAATGCGAGCAGGAGCAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGA
TCAGTACAGAGGGCTTCAGGACGCACTGCTGAACGAAGGTACAATTCAGCTGGAAGCAGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACG
TTGGTCCACCCTGATCGAGGCCGTGGTGGTGATACCCATTTTCTCAACCAAGTGGGACGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAG
CGATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCTGATGTGTTCATGACAACGACCTGCAGCCCTACATGGGAAGAGAT
AGTCGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAGCCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGCTTAAAGACCTG
AGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAAGAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAG
AGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCTGACAGAGAAAAGTTCCCGCAGCTATTCGAGACGATCATGACATG
CATGCTGCATGGACCCTGTGGAGCGGCAAACCCGTCATGCGCTTGCATGAAGGACGGGAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACA
AGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGACGAGCTGAAGGCGTCCTGGTATGGAAGGGCAGGGAGTACGACAACGCCACTATTAACC
AGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCACATCAACGTCGAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAA
GTACGTCTACAAAGGGTCCGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGGGTGGAGAGCTCCCTCGGCAAGAGCCAAACGAGATTCTGCGCTTC
CTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTACTCGACTTCTTGATCCAAGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACG
TCGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTTGGTCGTGGGAATCACACCATGTTGACCCGCTTCTTCGAATTGTG
TGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATACCCAAGGAATTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGA
CGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATATGGAGCGCTTCTATTTACGCCTGCTATTATGCCATCGCCGAGGAC
CGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGAGACGCGGCTGAACATGCCGGCTATCTGGAGAACGACAGCGAATG
GGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGCTCTTTGCAACAATCTTGGTCTACTCGGCGCCTACGGATGTTCGG
GGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCTTGACTATGCGTACAGGAACCGAGAGATGTTGGACCCTTTTAAAACGTCTGTTGTGACGTTCGACA
CACTGAAGAGTATCCAAGACTTGCTCAGTGTCAGTGGGTACTCCGTTCAAGACTTTGATCTCCCTCGGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTC
TGTTCTGCAAAACAATCTCATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTCTTGAACAAATTGTGAGCGAGGAGGACCACCTAAACGAGGAGCAG
CGCTTGACCTATGATCAGATCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAAGCTATTCTTCGTTGATGGACCAGGCGGTACCGGGAAGTCGACAC
TGCTTCGGAACATACTGGCCAAGGTTCGTCTATCCGGAAAAATTGCAATCGCGGTCGCTTCCAGTGGGATTGCTTCTCTGCTGCTTATGGGAGGTCGGAC
AGCGCATTCTACCTTCAAAATCCCATTGAAGATAGACGGCGAATCTACTTGCAACATCAACAAGCGATCCCAGGTCACGGAATTGATGAGGAAAGCAAGT
TTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGACAGAACGCTTCGTGATGTTTTGGATAACGAGGCAGAACCTTTCG
GTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAAATTCTCCCGGTGGTGAAGGGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATC
CGAACTGTGGCCACTTTTCCAGAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACCTCTGATAGTGCTGCTGAAATGGCTGCGTTTTCC
GAGTACCTGCTGAAGGTTGGCGAGGGGAGACACGAGGTACACAATGATCTGGGGAATGACTACATTAAGATTCCACGTGACATGCTCATCGACAACCCCG
CCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGA
AGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGG
CCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGAGGTGCTCAACTCCCTGAACATCAGTGGCATCCC
ACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGGTCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTGTGCAACGGAACACGCCTGCGAATCGTC
GAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGACAAGGCCAGCATGTGTTGATCCCGCGCATCGTGTTCATCAGCGATGGCGACA
TCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCT
GGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATATCAAGGGTTACGTCGAGGTCGAGATTCAAGGCATTGGTCGAGTAT
CCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCTGTTCGAGAGGGCGTAGGCAGCGACTTCGTGTGAATGCATATTTT
ACGAAAGGAATACATTTGTCACTTTGCATAGCGGTAATTGTTGAGAGTCACCATTCCCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAAGTCCGTGTG
CGAAGCACGCGGGTGAAAACCCAGGATCAAACAGTGCATGGTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTTTGATACAAGTCT
ACTGTAAAATATACTGAGATAAAACATAACCCTGTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCAC
CCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTT