Description :
From Genome Similarity Track
Location :
Scaffold_24:8797- 14887
Transcript NameFunction/comments
Phyta_totarag1314hypothetical protein
Phyta_totarag1315hypothetical protein PHYSODRAFT_347495
Phyta_totarag1316hypothetical protein

Sequence
6090 bases(100 bases per row)
TGCGGGCACAGCCGCTCACCGCCACGTGATcatggacgtgctggaccaCCGCAACGTGGACGCGCCACACGGGCGCAGCCGATTGCAACCTCGAGGACGC
CTTGGATCCCCACCTCATGGACCACTGAGACGCAGCCCGTCTCCTCCACGTGAATACGGCCAACATCCGGGATCATCAACTCGTGGATCACCCCCGAGTC
ACTATTGACCTCCGCCGGCGCAGTGGCGTGAAGGACCATCAAGCCACTAaaccgccaccaccaccgccggCGCAACAGTGGCGTGATGGGCCACTGCAAG
GCCTTGATGGATCGCCACGCCGTCACAGTGACCAGATCCGTTAACAGCAATTCCGTCGCAATGAATATTGTGGGCCACGTGATGGACCGTACGGCCATAG
ATTACTCACCGCATGGATCCGACGATCGACAGGACAGTGGGACCTGCTGGTTCCATGTTGCTGCCTGTTGTGAAGCAGGTAACTGGGCTGGTGGAGGACC
GTCTATTGGGTGATTTGGTGTACACCTGACCGCTCGGATCAACATCATTGGCCTCGGCTATCTGTAGATGACGTATCGCTACCAGATGTCGTGCGCACAG
TTGTCGAAACCAGATACGGTTCTGACATTCGAAATGAATGAGAATATCTACCGGCTCCGTGCTCAACGCGTGCCTGGTGTCGTGATAATGACCGCACTCA
AGTAAGACAGGAAGCAGATGGCGCTACAGCACCAGCGCTTCGGCCATGTCAGGTTGGAGACCGTGAAAACCTTGTCGAACAGACGTTGGAGTTAAGTTGA
ATGTAATCGGATTGAGCTCCTAGATAATGTTGCATGTGCTGCGAGTAAGGCAAAGCGGATAACTCATACACGAATTCCAGTGCGGAAATCCCAGTCGCGT
GAGACCTTGATGATGGATATCTGTACGCTGAAGACGTCCACTGTGGGAGGTGTGGTCACGTTTCTCTTTGTTATAGATGAAGCTACGCGCTACAAGTGGG
ACTACTAGCTCGAAAAAAAGAGCGAAGCCATCTTCCACATCAAGGTGCTATTGATTTGACTGAGAACAAAGCTGCCGGGGTTCAAAGTTCTACATCTGCG
GAGTGATCAAGGTTTTGAATTTTCCAGCAACGCGTTGCGAGAGTACTGTGATGAGTATGGAACCACCCAACAGTACACCAACGCGTACTCGCCGCAAAAG
AATGGCATCGCGGCGAGAGTGAACGGCATTATGATACCACGCGTGCGTGCCATGTTGACATATTGTCGGGAGAGGTACTACTTCATGTCGTGACGACGTT
GGACTCAAGCCAATAGGACTGATATCGCCTCATCAGAATTTATTCCGAGAAGCACTCATGCTTGACGATCTACGAATCTGGGACTGTATTACACATTTGT
GTGTACCCACGGAATcaaaacagcaaaaagagACACTGGAACCGAGGGCAAGACTGTCTGGCGGTATCTACTACTTGGCTAAAATGAGGACACGCTTGGC
CACAAGTTTCTTGACTTGCAGACTGCTCAGGTGGTGACTGCGCAGAGGCGCAATGTGCGCTTTCGGGGTTAACTGCTGATGGAACTTACGTacagcagtt
gctgaagaaTGCTTTCCTTGGTAGTGACCACCAACTAGCTGAGACTGCACCTGTGACTCGAATCAAGGTGAGTCCTGCTAATACGGCCGAGCTCTTTGAA
GTCGTatccattgctgctgtacccTCGGAGACGATGCCAAGTTCCAGTGGGAGTCTGCAAGGAGTTGACTCACCCTCGACTGTTGAGAGCGCTGACTTGC
AGCAAGATGTTgctccgcctgctgcagagccTACCATGATGACACCAGCGGCAaccaagacgcagaagaagcgacggAAGCGCCGTGAGCGAAAGAACGT
TgcagtggagaaggagactAGCAGTTTCGAGGCACAACCTCCAACTGTTGAGCCTCGCCTGAAAAAGACCAAGGCGAACCCATCTACCCAAGGTTGGCTT
TTGAATTACGTGATGGGCAACATGCTGACAACCATGGACGCGCAGGTCCCGACAACGTATGAGCAAGCTCGTGTGAGAAAGTTCTGGCCCCAATAGCGTG
CGGCCGTGACGGTAGAGCTTCAATCGCTGAATGGTCACAAGACCTCGAAGCTCGTGACACacgaggaggccaagaacatcAAAGTCATCACTTGCCGCTG
GGTATTCGCTGTCAAGCGCGACAAACGAGGACGGACCAAGCGGTTCAAAGCCTGGCTAGTGACACACGGTTTCAAATAGCAGCTAGGAATCAACTACAAC
GAGACCTATGCTCCTGTGATCTGGTTCGGGACCATTCGTGCGGTGTCGCGGTCCTTCTCCGTCGGGGTTGTAAGATCGAGTGaccgacgcagcagaaacC
CTTTACATCTAGGTAGTATGGGTGCTTAAGTGAGGTAGCATTTAAATGTAAAAGAAGAAACTTGTTGGTCTACTTTTTTCGTACGAAGAAAGATCACGAC
TgattcttcatcttgtggACAGCGAGCTAGTCACCGTACTCCTTCTTACATTCCGTTCCTTGCAGCGCTTCCGTACTTCGTTCCCTCCAATATAGTTGAC
ATCCCGTCTCTGTAACCACGTCAGCGGGCACACTTGAACCGTGCTATCCATCCCCACTGACACACCTTGCAACACTCGACCCTCACACGCCACCGCTGTA
GGATACTCTCATTCCCCGGTCTTCAATGGGGGACGGGCACTCCCACTCGTTGTCAGACCTGGCACGCAGTCGCCGTTGCCTGCGGCTGCAGGACAACTCT
GCGTAGTGCATCCACATCACACTCGCGGTTGATGCACTCCACCAATACCGTCAGTCCGCAGCCCCAGCCCGGCCCGTGACATCTATCCCCGACTCCAGTT
CGACGTCCTCGACAAACGACGTTTTCAGCGCAGGCGCTCGCGGGACGATCGACCCCACCACCAGACCTTGTACCACTCACAGTCGCAACCAGATCCGACG
TCTGAGCGTTCCGTCGCGGCACATGTACAGGCAGTACATTCGTCGGTGCCGTTCCATGCCGCAACTGATCCAGACTGACAAGCCCCTTAAGCGTACACGC
ACCGACACGTTCTTGCATATTGGCCCGAACTCTTCCTGCAACTTGCTTTGGCAGCGCCTTGGACGTCCGAGTTCACTCCTCATAGCGCCTCATCAGTCGG
CTGTAGCAGCCATACCGCTGTCACCATCACGCTTATACACAGGATCTCCATCGAAAACGAAAACCAGGCGTTAGCTCGCATCAGGGCTATCGCAATGCAA
TCCATTCCAGTAGCACGCCCTCTACTACATCGTAGACCACACGCGGCAAATACACCACCGCcgacaacgccaacaacaccagcaaTTAAATGCCAAACAC
AATGTCACTCGTGCGCCCGGCCATGGCCACCCGATCCTCCCAAAGGCCTTGTCCATACCGGAACGTTCCGTCGACATCTGGACAGCATCCGGAGTGAACA
CGCATAATGTATAGTAAATGCACCCCACCACTTGAGGATCAAACGTCCGACGATCCTAAATTCCTCGTCGTAGTCCCGAAGCACGGCCATGGGGAGAAAA
AGCAGCGCAATCACCACCCACACATACTCCGACGGAGTCATGGCCAGTGCCCGGGGACTTCTCACCGTCTCCAAGTATCTCTCAGCACTAGTGTACCAAA
ACAAAACCAATGCCCCGAAGCACTTACGCACACTGTTCGCGAAGACCCACGCCACGTTTCGCAGTGGCGTCGTCAATACCCACGCTACAACATCGAGCAT
GGCCCATCCGAACGGGGGCTCATCCACCGAGACGATCAGCAGCCATTCGTTCTGCACCAGGTCCGCTATCTTCTCCAGACTCTCCGTAACTCCGACATAG
CTCCCCGTCGCCGTTCACCTTCCAGGAAAATTGAGAATGGCTTGGCAAGGCGTTCTCGAATTTTCTTCGCCCTCGTAGCTAGTCACTACACTTCAGTCGC
CGTCCTTGGTCTGCTGTCGCCCTTTCCTTCCTTTTCTCGTTGGGTTTTGATGAGTGACCTAACCCATTCCCTATCTCAGACACCAGTTCTTCCAGGAACC
ATTAGAGACATGCATGCCCATTCTCcaatcttcttcaccagAGCACCATCCTCGACTGACTGTCTACTCCGTTCACGGTCCAAGCAATCTAGCGATTTCA
TGCTTTCCTAATCGAACTGCTGGGCCGTGAAACACGGGCGGGTCCCGCCCTCAACACACGCGCCATCAAAGCGGCCTTCTGGGACCCCCTACACGCCTGC
CTCACTCTGAACTACATGTCCAGCGAGATCCGGGAGCTAGCCAACCCCGCGCTCGCCCTCACGGAGACTCTTTGGTACGACCCGTCAAAGTATCCTGACG
TCCATCGCAATCACTGGCGCTTCTGGATGGCTCGCGACTGTGCATTGTGGGATTGGGCGTTCCACGCCCCACTCAACACCGAGGCTGCCACTTTTAATCG
TCGTAAGTTCAAGCTGCATGTCGTCTTCAGTTCCCCCGCCTCTGCATAGAGACGTGGGATTTCTACGACCCCCTGGAACTCCTTGATAAGCACTACCAGC
TTTTCTGGTCGGAGGCCAGCCAGGCCTCCGGAGTATCATAACTACACCGGCGCGCCCGGTGAGGATCTTACGGTGCTAGCTCGTCACGACGAGAAACGGT
ACAAATTCGGTATTGCGCACGCCCTGGACTCAGCGTTCGTTGACGACTAGGCGTACGACTGCATCCGATCTCTTCTCGAGACCGCTGGTGCGCTCGACTA
CACGACCAGGCCCTCCATCCGTCTCTCCGACGTGGCTCTCGCCCGCGTTCGGCGTGACATCATGTCCAGTCGTCGGCCTGACGCCTCTTGGGTCGGAGAC
ATGACCAAGGACCCGTGGAAGGCGCTCCGAATAGCAACCGCTTCAAGTTGAGCCAAGACCAGTTTGTCAAGGATCAGACCGACGGAAGCTATACGTCTCC
ATCCTTTCCTGCTGCTACCGACTCCGACACCAAGAACGACGACTTCTCTGACTTTGAAGTTGACGACGTGCATACTGCTCTTACTCCTCCCTCGGCcggt
gacgacgatgagcaAGACGGTGGTTCGGGTGCAGAGAGCGAGAACGCTGACTCCGACGACTCGAAACATTCCGTCAAAGTAATTTAGGACGTCCCTGACG
ACCTCCAGTTCTGCTACTTTTGCCTCTCGTCATCGTTTTTCTCGTAATTCTGTTGTTCAATTCCTGCGTTGAGCTCGCCACCGCGTAATTTTCAACCGCG
TCGTCATCCGTTCCATATCCTCGATCGAAGCGCTCCACGGCCGGTGTAATGGacctacttagcccaatactactcttacacgtgtgcgcgcgtgtatgag
gaagcgtaggtttctttgacttaactttattatacttgcgcccgcaagtataattaaaaCTAGATTAAAGCTAATTATTAACCCTATTGCTGCCGATTTA
TACTTGAAATTGTAAAATCAAGTTCCATAATAAAATGGATATTTGCTTGGTTTTACTCCGCACTTTGCAGCATGGTTTTACCAATAATTATTGTAATTAG
TATCGCAAAACCAAGCATATTGCTTAGTTTACCGCACCGTACCTGATTGGTCCAAAATAAATTATTAGCATTCTGATTTGCTCACAATAGAGGAGTTAAG
AGCACTTTGCACCCTGCACCCTGCAGGCAAAAATGCAACACAAAAAGTGCCGCGAACTTAACCGACGGTGTCTGCAGTGCAAAGTCCATTTTGCAGCCGT
AATTCTCAAAATCTCTGCAGCCAAACCGTCCTTTCCGCtgcatacatttagagagCTTTGCTGCTTAGAAAAGTGTCTTAAACTCGACACGCTGACGCGT
CACATGGCTTGAAAAAGGAAATTTCACTGCAAGATGAGCGCGAGAACGGAAAGCTTTTGCACTCAAAATTCCCTCAGAAACCATGCTCAGCAGTCTCATG
ATCAGCTCGACCTCTTcggatgaagatgtcgaagaaagcaaagctgctacatgtactataaTACATATTGCTGCTCCATTTGGGCGATTG