Description :
From Genome Similarity Track
Location :
Scaffold_790:8797- 9800
Sequence
1003 bases(100 bases per row)
AGTGTGCTAGTCAATATCACTATTTGAAATACAAGAGTATATTGAAATCAAGTTAAAACTGTTAGTGGTAATTACGCCTAGATGTCTGTTAAAAAGAATA
AAGACGCTTGGTAAAACCTTTTTTAAAATCGGACATGTAATACAATATTTTTACGCGTCTTTACTACCATTGCTCTATTTGGACGTTGTCTGTGCTGGTT
CTGTGAGGGGTCATGACGAAGTCATCCCCCCTCCGTGGAGAAGGTTCGCTCCCAAAATTCGGATTTTGTCCAACGGAGCACTCTTCGAAAAAGTGGACCA
CACAACAGTTGGTCGTCGTCAGTAGTTCTGTAGTACTATACTACAGTATCAATAGACGGAAGGTCTGAGCAGTGCTACTACTGGCGAACTACTGGTAGTA
GTCAGAAGAATAGCCGTTACTATCAAGCCCCTGTGGTGACGGTAATGCAGACTCCACTAATGATATATAGTAGGCAGGGTATACTACAGGCAGAGCGCAA
TAGTACACCGAAGCCATCAATGCCTTGTCTACTTCTGACAATACTGGAATTTAGAACGCGTTTAGGTTTTAGTGGGCATAAATTCAAAGTTGTTCGTGAA
GTTTGATTCTAGATATAGCGTGCATTTCAGATTTGGAACATCAACTCAGGTGTGGGATTAATTCTTCCATGAAGTTCTAATCCCAAATGATGAAGGTTTC
AAACAGCTTTCGCTGAGATGGTCGGGACATTTTTATACCTTGTTACAATGCCGTCCACAAACCAAACTGATCCCAACCTCAAAAACTACCTTCGGGTGTC
ACTAATTTTCATGCGCACTTTATTATTCACTCTGGTGTCCGAGGCGCTTGTCATTGATTTTCATGCACACGTTATTATTCACTCTGGTGTCCGAGACGCT
TGGGCGATCAGAGCCAGCCAGCATGTTGAGTTTGTAGTTTGTATTAGTACCAAGACCACTCCACTGGACGGATTCAGTATTCTCATCTTTGTGTTTCATT
AAG