Description :
From Genome Similarity Track
Location :
Scaffold_2:87969- 93896
Transcript NameFunction/comments
Physo_110399predicted protein
Physo_127438predicted protein

Sequence
5927 bases(100 bases per row)
TGCACTAATGAACGCTAGGAGTGCGGCGCTAGCGCAGCACCTCGTGCCCTCCACGTACGTCCAGCAGGGTCTTGATGCAGTTCGCTCGCGCGAGAAGTTG
GTGACATCTCTGCTTGCCCAGCGTCGCCTTCCCGATGAAGGCTGGGACGACGCCAGCGTGGAGCTCCTGCTGCAGACGCTCTCGGCCATGGACAGCAACA
ACTTCCGCGGCAGCGCAGGCGCTGGCGAGCGCGAGGCGCGCGTTTTTTCTCCGCTAGTGGCGCGCCGCCACTTTTACTTGGCCCACGGTGTGGGCAGGTC
GGGCGACGTGGCGGCGGTGCAGCCCAAAGCGGCGGGGTCGTCACTCTTGGTGCAGCTGGCCAACGCTCTGGCCAAGGACGTGCTGCGTCTCGCTGGGATG
CGCGCAGTGCAGGCGGCGCTAGTGCTGCCTGTGGCCACGGGAATGTCGCTGACACTAGTGTTGCTGCAGCTCAAGGAGTCGAAGCCGCATGCGCGTTACG
TCATCTGGCCACGGATCGACCAAAAGTCCTGCTTCAAGTCCATCGTGGCGGCTGGACTGACGCCGCTAGTGCTGGCGAACGTTCTGGTAGAACAGGAGGA
TGGAAAGCCTGGTGGGTTCCTGAAAACCGACTTGGTGGGAATGACAGCGCTGATGGACCAGTACGGGAGCGACAGCGTGTTGGCTGTGATGAGTACCACG
AGTTGCTTCGCGCCACGGGCCTATGACAGCGTGGAGGAGATCGCCAAGCTGTGCGAGGAGCGTAACGTTGGTAAGAGCCTGGTCAAGCGAATGAGTTGTA
GCATTGGCTCACATGAAGGGGATGACTGTGGTGTGCTGTGTGAAAGCGCACGTGATTAACAATGCGTACGGCGTACAGGCATCTAAATGTGTGCACCACG
TGGAGCGAGCGATGCGCACTGGTCGAGTGGATGCTGTGGTGCAGAGTCTCGATAAGAATTTCATGGTACCTGTGGGTGGAGCGATTGTGTGTTCGGCATC
TCGCGAAGTAGTCGACCGCGTGGCGAAATTTTATCCTGGACGTGCCAGCGCTACGCCGACACTGGACTTCTTCATCACCATGCTTCAGATGGTTGGTCAG
TTTGACTTGTGCTTCGTAGTTGTCCTTGGTGAATAATGCTACTCAACCGTTATGTGTTGTCAGGGGAAGCATGGGTACAAACGGCTACTGGAAGAGCGCA
AGCACCTCGCAGCTTACATGAACCAGCAACTTGAAACACTCGCAGCCGATGAAAGAGAACGCGTACTGCTCGTTTCGAACAACGAGGTAGCACTAGTGGA
CTGCTGTGTAGGCGGTTGGCAGCTCGGCGGCATTTCCATATCTAACGCTTTGCATGCGCAGATCTCCTTCGCGATGACACTGGGCACGTTTTGCTCCGAT
GTCACGGACCTGCAAGAGAAATCCCGACAGCTTACGTTGCTCGGCGCTATGCTGTTTTCACGTGGGGTATCCGGTGCACGGTGAGTTCAACGCTAATCCA
AGTGGAGGTTTGTTAGCCGTCGCTTGACACTCGGGTGCGTGCTGCTCCAGTGTGGTGTCATGTCTAGACCGCAAAGCGATCGCAGGGTATGAGTTTAATG
CCTTTGGAGCGCACCACGACGGCTTTCCAGTAGCTTACGTGACGTTTGCGTGTGCATTGGGCATGCAGCGTGGCGAGGTCGACTTGCTCGTCACGAAGCT
GCGGAAAACTATCCACGAGTGGCGCACGAAGCGTGTCAAAGCAGAAATTGCTGTGTCCATGACTACATCCGAGGGCTTGGCACACGAGAACGGGAAATAG
GTGGGGCATCAAGAAGAGGAACGCGTAAATTCCATTCACACGAAACACTGTCTATAAATCTGTCTGCTGGCGTGCTACCTTTCTGCTAGTGATATGTCTC
CAGAGAACACACACGCTTAGTGCTTTTTGCCGCCGCTCTTGGACTTCTTGCTCTTCTTCTTGGTCGTAGGCAGCGACACGGCTTCATGCTCCGCCTCGGC
CTTGAACTCGAGCTCTCCAAGGAGCTCTTTGGCGATGGCATCGGCCGCCGCCGCCGCATCCACTTCCCGACGGCCTTTAGCGCCCTCCACCGCCTTTTCC
GTGAATTTGGCCATGAACTTCGCCGACTCAATCACGCGGGGGTCCTCATCGCCATAAGCTTCCTTGTAGAGCGAGTACACTTTCTTCTCGTACGCGAGCG
CCTCGCGGTAGCCGCCAGCCAAGCCACATGCCAGAGCCATCTGACGCAGCGTGTTTGCCGCCTGGTTGCGGTCAAACTCACCACGGCGGAGAGACTCGCG
GTGGCACATGAGCGCCAGCGTAATCTGCCCCACGTCCTGGCACATCATGCCCATCTTGAAGTAGAGCGAGCTGATCTCAGGGAAGTGGGGTCCGCAGCAG
AACTCCAGCAGGTAAATGGCACGGCGAATGTGCGGCACTGCCAGTTCCGTCTGGGCGTTGGCGTGCAGGAACAACGCTAAGTTCGCGTGCGCAAAGGCCG
TGTCGTGGTAGTCAGTGCCCTGTAGCTGCGTGTACAGCGCCAACGCGCGCTGCTGCTGAGCAATAGCACCAGCAACGTCGCCGGCATGGTAGAGCACTGT
AGCAAGTGACGAGCTGCACAGAGCTGCATCCTCGTGGGCAGCACCACACACCTGGAAAAGCAGCGATGACGCCTCCTGGAGGAACTCGTACGAGCTCGAA
AGCGCGCCTTGGCTCAAGTGCACGCGCCCACGCTCAAGGAGCTGCTTGGCCTGCGCCAACGGGTGCGCAGGGAGAGAGCTCTTGACGACGGGCACAACGC
CAGTGATGTCATCCAGGGTGATCGGTGCGGCACACGACGACGAGAAGTCATAGTTACGGCTCGCCACGCGCAGACCCAGACGCTGGCACAAGCGTCGAAG
GAGGACGGGTTTGTGCACGCGACCAAGAGGGGCAGAGTTTTCGCTTTGCTCCACTTCGCGGCCAGGGCCCCAAAGAGACAACTCGTAGTCAAAGCGTGCC
TTGATCTCCTTATCAATGCGCGCCCGCAGTGACTTAGCGTTCAACGAGGCCGTCGTGATCGCAGTAGCATCGCTATCATTAGTCTCCTCCTTGTCCACCG
TAGCAGAAATTGATCCAAGAATGCTGTTCAGGAGCTTCACGATAGCAGATCCCGGGGCGGCACGGATAGAGTCGTTTGAGCTCAAAACATCCGCCAGGAT
GTGCTTAGCTGCGCGCGAGATCATCTCCACTTCAAGCACCTCCAGCAAGTACTTAGAGATACCGTTAATGGCCTCCAGCTTCTTAGCAAGTGACGCCAGG
CGGCCCAGGTAACGCATGTTGATACCGCACGAGTGCATCAGCTCAGTGAGCGCATAGCCATCAGCAGGGGCAATGGCACCGCGACGCACGTCCGCCACGA
ATGCGGGAACAACAATTCTCTGCAGGTACTCAGCGGCGTCCTTTGCGGCAGCTTCGTCAGCGTCGACCTGTGCTGCGTCGGTTGAAGCCGCGTAGTCCAT
GAAAACATTGGGGTTCAACTTCACCGGAGGAACCTCTTCCTCCTCTTCCTGCTCGCTCTCTTCGCTTTCCTTCTTCTCAACCGTGTCATCACTCTTCTTT
TCAGCATCAGCCTCCGAAGTTACACCCTCCTTCTTGTCCTTCTCCGCTTCCGCTTCCTTAGCCTCCTTTGCTGCAAGACGAGCCTCACGCTTGGCGCGGC
GGGCCTGGTTCTGCTTCCACAGCGAGTACAGCTGAACCAGTTCCGGGCGCAACAGAGCCACATAACCTTCATCGTCACGAGCAAAGCACAGACCATCGTC
TTCCGGCGCAGAAGTCTTCTCCTCCGTGTTCTTCTTAGCAGCCTCACGGTTCTTGTAAAACGTCCAGTCCTTCGGTGTAATGCGGACGAGATCCAAAACA
TACTGGCGGCCGTCGGAACCCTGAATGCCCTTGGCCTCAACGGCACCACAGATAGTGGCCACATCGGTGCTTGCTTCGCCCCCGCTCACTGTAACACCAA
GACTCTCCTGCTCCTTCTCGGCAGCCAGTTCTTCGTCGCTCTTGCCAAGTGGTATGATACTGCGCTCCGCAATGTGAAGCTTTTCACCAGCCTTCAGCAT
AAGCTCGTGCATGGAGCTGTTAGCAGCAATAGTCTTGCCGTGGTCCACCGATCCGTACACAAGCTTGGAGGCCGCGTCTCCCAGAAGGATGCCCGGGATC
AGGCTCTGGGCAATGACACGGACACCAAGGTAATCCACAACCGTCGTAGCCAGCGTGTGCAGGCCACGCACGTCCACTTCATTGAACGCCTTCACACCCT
GCAGGTCGCGGTTGGCAGCCGAGTACGCATTCTCCTCGCCGCCGTCCTCCTTGGTAGCCTTGCCATCAATGGACACCGAGAAGAAGATGTTGTTGAAGAC
GTACACATGCGCACTCTTGTCGTCCATGGGGTTGATAGGAGGAATGTTTCCTTCAACAATCGCCACCGCGCCTTGCGTCGCGGCCTCCACAAACTCCGTC
ACGATCTTGTACATGACCCGAGCGCGAACAATCTCATCCTTGAGCGAGTCAGTCGGCAAGTCACGGCAGCATTGGTACTCCTCGTTCCAGTCACGCAGCA
CGCCGCGCTCATCCATACCAAACGACGAACAAAGCTCGTCTTCGGCACGGTTAAGGTCGTACGCGTGTTCCTCCGATGCTGCAGCAATGGGGGTGTTCCA
GGGAAGCTTACCGCCCAGGTTGGAGCCAGCGGCCACCATCCACTCGATCGAGGAAGGGCCCTCCTTAGCCAGGGACGCGGCCTTGGCGAGGAGAGCAGCG
TACGACTCGCGGAACTTGGGCGACACGGTGCTGAGCACATCCAGCAGCAGGTGCGAGTGTGCCGCGGCGGTCTTGTGCGGGCGCGGGTCGAACTTGGCGG
CAGTCGAGCGGTTGACGAAGAAGCCGTTGACGTGCGCCGTGATGTGGTAGCGCGTGTTGTCGCCTACGACCGACACCTCGAGGTAGAGCAGATCGCCCGC
CAGTTTGCGGGGTCCCGGGGGCGGGTTGTAGCCCGAGAAGACGATGCTCTTGACGCAGGCAGGGAGCTTGGCGTCCGGCTGCTGCTCCTGCTCCTTCTGC
TGGTTGGCATCGTTCTGCTGTTGCTGCTTCTGCTTCGGCTGGTTCTTCTTGCCCTTCTTGCTCTTCTTCTGGTCCTTGCCCTTGCCGGGCGTCTGCTCCG
CCTGCTCCTCCGGCGCGGCGGAGGCGGCGCCCGGGAAGTTGTAGAACTCGGCCAGCTCGGGCTTCACGGGCACCTCAATGCCCTCGAGCTTGTGGTGGAT
CTCGCGCAGACGCTTGAGCTGCTGCTCAGAGATTTCCTTGAGCTTCTTCTCATCCAGCTCCTCGCCATCGGCCGGCTCCTCGACCTTGTTGTTGGCGTCG
GCGGCAGCTTCAGGCTGCGCCTCGGGTTCCGCGGTGGCCTGGGGGATGGGCGGGTTGCTCAGCACGTCACGGAGGCGACGCACGTGCGCGCGCACCTTGC
GGGCGTCGTACTTGTCCAGCACCATGCGCAGAGTGGCGCCGTCCGCCACGTCCTCGTACTCAGCGAGCTCCACGAAGTCGTTGAGCGGCTGCCAGGCGCC
GTCCACAAGGCTCTTGGCCTCCAGGTGGTAGCACGTGTAGCAGGCGAGCGCCGGGAACTCGGCGATGAGCTGGCGCAGAGACACCACCGTGTCCGACGCG
CTCACGCTCTCGAGACGCACGGGCTGGCCGCCCTTGGGGGCGGGGGGCGCCACCAGCACGCTGAAGGTCTGCTCCTCCGCCACCACGGCCTGCTCTTCCG
GCTGCTGCTGCGCCGGCTCGACGGTGTCGCTGCTGCCCATGGGAACTCGGTCTTGCGCTGCTGGGCTCTGGTTGCGATCTGAGGTCCAAGTGCGTTGCAA
CGTGTGGTGCGAGCGAGGAGGTCCCGC