Description :
From Genome Similarity Track
Location :
Scaffold_2:879258- 900227
Transcript NameFunction/comments
g1569.t1XP_002898311.1 conserved hypothetical protein [Phytophthora infestans T30-4
g1570.t1XP_008902292.1 hypothetical protein PPTG_09174 [Phytophthora parasitica INRA-310
g1571.t1RAW33626.1 hypothetical protein PC110_g10039 [Phytophthora cactorum
g1572.t1hypothetical protein
g1573.t1RAW33631.1 hypothetical protein PC110_g10037 [Phytophthora cactorum
g1574.t1POM70483.1 Hypothetical protein PHPALM_13066 [Phytophthora palmivora var. palmivora
g1575.t1XP_009532016.1 hypothetical protein PHYSODRAFT_361407 [Phytophthora sojae
g1576.t1hypothetical protein
g1577.t1XP_008902302.1 hypothetical protein PPTG_09181 [Phytophthora parasitica INRA-310
g1578.t1XP_008902303.1 hypothetical protein PPTG_09182 [Phytophthora parasitica INRA-310

Sequence
20969 bases(100 bases per row)
TCGCAGGCAGCGTGCAGCGGCGAGGAGCCGTCCTGCGCCACGTCGTTGGCGTTCGCGCCGCGCTCGAGCAGCAGCGTGAGCACGTGGTGGAGGCCGTTGG
CGGCGGCCACGTAGGCGGGCGACTGCCCCAGCGAGTTCTTAACCGTGAGGTCGGCGCCGGCGTTGAGCGCGTCCATGACCTCGGCGAGGTCGCCTTTGGC
CACGACCTCGAGGAAGCGCTTGCGCTGCTTGACCGTCTTGATGGCCGCCAGCTTGTGGCCGAGGAAGTGCCAGACCTTGGCGCCGCGGTGGCGGTAGCCG
TGCAGCAGGTGGTGGACGGGCGTCGCCTTCTTGGCGCTCACAGGCACGAGCGCGCCGTCCGTCGGCTGCGGGTACACGTAACCGCGCGCGGCCTCGAGCT
GTTTCACGGGGCCGCTGAGCGTCATGTCTGTCTGGGGGTAACTTCTCGACTGGAAGGTGGGGAGGTGGACGACAAGCGGGTGGCTTGAGGTTGCTATATA
GAATATACGAGCCGGAGGGTTCGATCGATTCGCGGCTGTCGGCGCGGCTGGGCTGTGCTGGGAATACCTGCTTCCAACCGAGGCGGAGCGAGGTGGAGGC
TTGTTCGCTCGAGACTGCGGATGTTCGAGTGAGCGCTCGTTTTCCAGCGAAAAGCAGTTTGTGGGCTCGGAAGCGGTGGTTAGGGACATGGATAGACAGG
GCGGCACAACGTATAAAAATTGGCGATGAAATCGATTGTCACAGGGTGTAATGCATACTGAAGGCCCACTGACTCGCCGAAGATATGAAAGGGTATGTGG
AGATAGAATCGACACCTCAGTGTTCAGTGCTCGGAGCGCTTCGCGCCATCCACCTGGCAGCACTCGACTTGACCGTCAAGTCTTGAGCCCGCCGACAACA
ATCAACTCGGGGCTTCTTAGCGCTGTGGGCCACAGCGTGGCGGCGAGTGCGTAACGTTGGGGGTATCTATTTTCCGACCATGAGGCTGCTGCGTGCGAGC
TGTCCCATACCTCGGCGGGGCGGGGGCGGAAGATCAGTGCGCGGCTCTTCTCTGCGTCTTTGCGTCATGGGCTCCGGCGCCAGGTGTCAGCCTCCGCTCG
CATGGAGCTCCCCGCCGTTCCATCGTGTCGGCAGCCCATTGGCCGTGAGCGGGGCAATGAATCATTGCCAACGGAGTGCTGGCTTGACAAAATTGGCAAA
CTGCAGGAGCTAGCCAGGCTGGTTGGTCAGCTAATGAAGTCACGCGGTCGGTCGGCTATCGAGCCTTGCCCGCGCAGCACCGTCAAGCTACATGTACATA
CATGCGGTCGCTACACGCTGGTGGGCTTCTCGGCGACCCTATGGCCGTGCTGCACGATGTGCAGGACTTCGGCACTGAACAGGAATCCCTTGATGATGGC
TCGGCAGGCTGCCAGCCTGCCAGCAGCTCACCTCTCTGGTGTCACAGCAGTATTAATAACAGCATGCACGCCAACTGAAGACTCGCTGGTCATGCTCGGT
GACTGTTGCCATAGTGTCCGCTGCGATATTTACTCCATGCCGATGCCGGTGGCGCTTTTCACGTCGCTTGAGTCGTGCTGCCACCGAGATGCAGCAAGTC
GTTCAGTTGAAGACGCTTTCCAATGCCTTTTAGTGCATGCCTATTTTTGAAAATAGGCGCTATATACCTATTTTGCCCAAACAATCGACATCGAAATCAA
AATCGGTGGCCGGAGCATGCTGAGAACGATGGCTGCTCTTCCGCCCGTAGCTCGCTTGTCCGTCGCGCCCATGGTACGAAGCCGCTTGCCAATGGACCCT
GCACAACGCATGAAGACGCTGACGAGCTCCGTGCTTTGCCGCAGATGGATTGGACAGACCGCCACTACCGCTTTATGATCAGAATGATCACCAAGGAGAC
GCTGCTGTTCACGGAAATGGTGGTGGACCAAACGGTGAGTCGCTGCTGCCACCATATCGACTGCTGCGTCGCAATGCGGCTAACTAGTAGTGGCTCGCCC
TTTGTCCGCGACAGTTGCTGCACCAGAAGAAGAACCTCAAGTACTTCCTCGGACACGACCCCGTCGAAGCGCCACTGGCGCTGCAGCTCGGCGGCAACAG
CGTCGAGGACCTTGGCGGTGAGGTTACTTGCTCTTGTCGTATCTGTCGGTGTTGGTACTGACATTCCTGATTGACGCAGCCGTTGCTCATCTGAGCCAGA
CGTATGGCGGCTTCTGCGAGATCAACCTCAACACTGGCTGTCCCAGCGCGCTAGTGTCCAGTCGCTGTTTCGGCGCTCGTCTTATGCTGGAACCCGAGCG
TGTGCGAGACATTTGCGCCAGTATGCGGCGCAGTGTTGCGTTGGCAGCGGAAGAGAACCCGGACCGACCGGCGGCTGAGGTGACGGTAAAGTGCCGCATC
GGCGTCGACGATTGCGACAGCTACGAGGAGCTGCATCATTTTGTGGCCACTGTTGCAAGTGCTGGCGTCCGCCACATCATTGTGCACGCGCGCAAGTGTA
TTCTCAAGGGGCTGAGCACCAAGGACAACCGTACGATCCCGCCGCTACGCTACGATGTGGTGTACCAACTGAAGCAGGACTTCCCCGAGCTGTCCTTTAC
GCTCAATGGTGGCGTACAGAGCATCCAGCACGCGCGTGAGCTGTTGGACACCACAAATGTGGACGGGGTTATGATCGGGCGAGCGGCATATAACACGCCA
TGGAACTTCCGCGATGCTGACCGACTCATCTTCAATGCCGAACGCAACCCCAACCTGTCGCGTCGCGAGATTATCGAGCGGTATCTGGAGTACGCCGAGA
ATCTACAGGCGAAGTGGGGGTCGACAGTACCGCTGGGCGACTCGCCCTACACGATGGCCACATCCGCGCTGATGAAGCCACTGCTGGCGCTTTTCAAGTA
CGTGTAGTGTCTATAGGAAATCAATGTGGGTTGTCGCTGAATGCGCTGACATTTGTTAAATGCAGCGGCGAAATCGGCGGGAAGGCTTTCAAACGTGAGA
TCTCGGCGCAATGGGCGAAGAAGGGCCCGCGGCCAGAGCTGCGTGAGATGATCGAAAACGCCATGAAGGTCCTACCCGACGAGGTGTTGGATGCGCGTGT
TGAAGACGAGCTCATCCAGCAAGAAGCTTCTCGTTTTGACGAGAAATGCACAGCCAGTTGCAACTAGACTTTGTGCAACGCAATATACCATACCATAGAG
ATATTCTGCATTGCACTTCGAAGTATTGCTTTATGACTCAGCCTGCAGTTGCTCCTGCAATTCCTGAGCCGCAAGGTACTCGAGAGCTTCGTCGATGATA
GTGTATACGTCTTGAGGAGTTTGAGTACGGGCCATGCGGTCACGTAGCTGGCGTGCGTTAGGCACGCCTTTCAGGTACGACCCGTAAAACTTCTTCATGC
GCTGGAAGCCCACCAGACCAGGGTCGCCCAGCATCTCTTGGAAGAGCTGCGTGTGACGCTGGATTACCTCCAGCTTCTCTTTCACAGGTACGTGTGACGT
GTCCGGGTAACCCTGGAAAAGCCACGGGTTGCCAAATAACGCGCGGCCAAACATAATACCGTCGACACCGTACTCGTCAACCTTTTGCTGTGCCTCAACG
AGACTTGAGACGTCACCGTTGCCGAGGATGAGAGCTGGGGACCCCGCAGCTTTCGCCAACGTCACAATCTCACCAATGACGTCCCAGTGGGCCGGAACCT
TGGACATTTCGTCCCGTGTCCGTCCATGGATAGTGAGGACCTCCGGCTCCGTCGCCAACAACCGCAGCACCCAGTCCTTGTAGTCGATGTGGTGGAAGCC
GATGCGCGTCTTGACCGACACCGGCAGGTCTCCAGCGCCGCGTTTGCACGCAGCCACAATCTCCACTGCCAACTCTGGCTGCAAAATCAAAGATGCACCG
CTGCCTTGGTTGTTCACGTTCGTCTCGGGGCAGCCCATGTTGATGTCGATACCGTCGAAGCCCAAGTCACGCACGATCATGGCCGACTGGCAATTGGCAA
TTGCAAGTGTCAGAAGCGGCGTCGGGTGCAATATAGAGTGCTACAATACAACAGTAACAAGACTTACCTCGTAGAACTGCTCTGGCTTGGAGCCGAAGAG
CTGCGCCACCACTGGCCGCTCCTGCTCCGCGTACTTGAGAGTGGTCATCATTCGGCGGCGCGAGCCTGGGTCGTGTGTCAGCGCCTCGCAGCTCACAAAC
TCGGTCCACATGACGGACGGCTTGGAGATCTCACTGATGAGGCGGCGGAACGGTGCGTCCGTCACGTTCGCCATGGGCGCCACACAGTACAACGGCCGCG
CCAGCCCCCGCCAGAAGCTGCCCATGTTGTCTATTGGATGGCGCAAATGTATTTGTGTAACGATGGTGTGGGAGAGTGATGGTCTCAAAGTTGAAGTTAC
CAATTTCACATTCCGCGTCATGGGCAGCAGGAAGATCACGCGCAGCCGCGGCGCCAGGGGGCAGCTAGCACTGTACAATCCCCAAATGGTGCCCAGTGAA
GGTAGAGGCAGCATGCGAAGCTCCTGAACACCCGTTGATGTGACGGAATGGTACTGTGTAGTGGCTCAAGAGCTGGAAGGAATCTATGGATTCCGCCCAC
AAGGTGAGCGCACAAGAACAATATATATCGACCAAAGTAATGTGCTGACGCTGTTCTGGCCTGCTCTGTAGGAGCGACAGGCTGCCTCGCTGGTAAGCAT
AATCTATTGCTGAACGAGCGCGCGACTCAAGGAGTGTTTCAGACATCATGATCTCGCAGCAGAAGGGAGAGTTCCCGCCTGTGGCTTTCATGGTAGTGAC
CGCAACTGGTTGTGAAGTGTGGACCATCACCCTGCAGTTGTTAACAAGGGCCTTATAGCTGATACACAAGGAAGTTCCTGGGTTCTCCATCGAGGGCGCG
ATCGACAGGAAAGAGAGTCCTGTGTGTGTGACCTGCCTTAACGAGATAACACATCTGAGATCATTGATCCTAGATTGCAAAAGACCGAGAAGGCGTTTGG
AAACGCGTTTGCGATTGCTGTACTTCCGATGCCGCGGTTCTCAGACCTGCAACTACTCGCCGTTGCCAATTCAGTACACATCAAGATTTTTACGGGTAAA
CAATTTCCTCGAAGTTGATGCTGACGTGCAATCTCGTCGTCTAAAATATTTTCGGCTTCTTTGTTTTGCAGTTTTCAGCATATCCGCCGCCGTCAAACTC
ATGGTCCGTTCTTATATGGTTCAAATCTGAGTCTTTTTGCCTATTCTGACACGGTGCAGGTGTCTGTGCACGAGAAACTTGCTTTTCAAGTCTCAGAGAA
GGCCAACCAACTCAGCCAGCACGTACGTTAGAGAAGGCACTAGCAGTGCTTGTTGCAAGACTCTTAAATCTGATCTGCATTATGTCAGATGAGCGATGAA
CTGCTTACTCGAAAACATGCCATGGATACGCTGAAAGCGAATTTCTCGTTCCTCAGCGTGGACGAGTGTGACATGCTGCTCGATCTCTTTGGTGCGTATT
CTTGTAAAACATGTAGGCTAGTGCTGTATCTGATTCCATGCGCCGCACAGGTAGCATCGCGGCCATTGCCCAAGCTGGAGCGGAGAAGTTGCTGGACGTG
ACGGTGCTAAGTACAGCCGCAGCTCACGCGATTGAGGAGTTTTTCAAAACTGAATACGCCGTGGACTAGACCCTCCGGGGCTTCCACAGTGCATTCTCTT
TTTTGAATGGCGCGGATACCTACGTAAGCTAATGGTCGCTAACGACAAAGACACAATCTTCATTCCTGTTTCCCGTAAATACACATCCTAGGGTGCATGT
GCGCACATGCAAGTTGAATGGAGATCAAGCATGAGCTGCCGCTACGTTATCTCCATCCACGCGGAAAGCTTTCAGCTGAGGGCACTGGGAAGCGATGAAG
TCGATCTGCTCTCCTTTCAGACCACGCGTGAACGCGACACTGAGCTCGTGAAGCCCGCGCATGCGCCTCAGCTCTGCACCCAACGCGATCGGATTCGAGA
TGATGCCACGGCACCCGCCAATATCCAGTGTTTCAAGTTTGGGGCATGAAGTAGCCAGCGAGCTGAGCACTAAGCGTGTCAACTGACCTTGTCCGCAAAG
AGTAAGGTGCTCCAGCCGCGTGCATCGCGAGACCAGGTATTTCAACGCGTTGTCTGTGATGCCTCCTCGGCCAAATCCAAATGGGTTGCTCCGTGAAATG
TCCAAAGACGTCAACCGCGAGCATTGATCTCCGAGGGCCAACAGGCAGTCGTCTGTCAGGTTCTTTGCTCCACCTACTAGGAGTGTGTCTAGCTTGGGGC
AGCTTTTGGCAATGCAGGCGACTGCGGAAGACGTCACGGCTGGGGATCCCTTTAACTTGATCGATCGCAGACTGCCGCAGCGTTGAACCAGCGCTTCCAC
GCCGTCCTTGGAGATCTGTCTACAGTAGCTAAAGTTGATTCGTTCCAGCGAGTGCGAGTGGGCGTCGCCGACAGCTTCCAGCGCTGCATCTGTGAGTCTT
AGACATTTGACTGCACGCACCTCTACTAGCTGCTGACACGACGCCTGGACGATCGCCGTGAAGTCTTCATCCGCAAGCGTTTGGCAGCCGGACACTGTCA
AGTGAGTCAGGCTGGAGAAGAGCTTGGCCGCCTTCACCAAAGCGCCTTTCGGTACGACACAGCCGACGAGCGTCAGCCTCTTGACCTGCGGGCCGTGCCG
CTTCGCCACGAGGTTCACGAGTGTGGACGCATGTTCGCTGTTGTGCCACTGGTGCTCGAGCTGTACGTGTCCCCAGAAGCACGCGATCGCTAGCGTCTGT
CTCCACGAGCGGCTCACCCGCTCCAGTGCTAGGAGATCGTCCACATACAGGAAGGAAAGCAGCTCGCTCAGCACGGCATCCGACAGGGCAGTGGCCATCC
TTGGTGCGTTCCGCCGCTGCAGGTTCACAAAATGTCATGGGCATCCATGTCGCGCGGGCAAGGTGTCCATTACGCCGCCAACCAAAATGCAACCTTTTGT
CGATGTGGCACAGATGGCTAAATGTAGCCATGTCCTCGGACACATACCGTGATCTCTTCTAAATACTGAACTCGCCTTATAAATGAAATAAATTGCGTAA
ATTATTAAAGCCAAAATGATTATTTTAACTTATTTTATGTTAAAATTAGAGGATTTGACCAATCAGCGACATTGCAGTGAATGGCGTGGTTAAGAACGAG
AATGGAATTGACGAAGGAAGACATTGATGGTGGCAAGTAGCGTGGCAACGTCCTCTCGATCTACGCCATGGACGCCAACTACTCCGCCTGCTACAACGAT
GGGTAACGCAGGGACAGCAGGGTTGACGACAGCAGCATCGACGCGGTCTGTCACAAGCATGACGGACGCGCCACCTGTGACAACGACGGTGACATCAACG
ACTGTAGGGTCGATGCTGGCCACCACGAATACGACGGACACCTTTCCTGTGGCGATAACAACAGAACAGCGATGGTGGGGGGTCGACATGGTCCGCCACG
ATCACGATGGGTCTGTCTCCCACGACAACTCTGAGGACGACGTCGCGAAGTACGGCGACGACAGGACCGGTGTGGCCCACGCTAGCAGCAACGGCCGCGT
CACCCGTCACGACAATGATGACTACGAGTGTAGGACCAACTCAGACGCCGGCGACAATGGGTAATATGCCCGTTGTAGCTAGCATAACGGAACTGACAAC
GCCGCAAGGTCGTGCCGTTCCATATCGTCACGACTCCGACCGTCAGTACAACTCCGACCAGCATCTGACGTTCCGTAAAAAATTATATCGCACCAGGTTG
TGGGGGTTTCGTAAAAGTACATCCTCTCAAATGATTGGCTTATTGATAGGTGGTAGATGTAATTACGCCTCGTAAATGAGTGGTGTACGTGCAATTTTGC
TGCGCTATTTTGCCATGCGAGCTCAGTCCTCGATTGACCACCCGGCGCAGTGAATTGAGGAGGGTGTACCGAGCATCGGTCACCTTAGAGGGTTGTCGCG
GCCACGAAGAACTGTGGACCACCGTTAATTCCCCGTCGAGCACTCCAGATGAGTACCCTGCGATGTTATTGTCTAACCTCACCGATGTAGGCCAATGGAA
GAGCTCCCGAAAGAAATAATGTGGTTCGATTGCGCCCATCGGTAAATTTTCTATGCTCGAATGGCTGCTGCAGACCTGACATCAATGCGAGCACCGACTA
CAAGGACGCGGGAAAGGGGATCGTATTGCGTTACGGGAACATTTTGAGTGTGCCTAGATGCAGGGTCTACAACTCTGTCGCTGGCGATAGGCGTTGATGA
GGTCGTTGAGGCTTCCCTCGCGATACAGCTGCCGAAACGCCTTGAGTACAACGTTGGATCCCTTTGACGGTACGCCTCGCGTGTAGCGGGGCTACACATT
CGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTCAGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAG
AAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGG
AAACCCCATTTACAATCAATACAGTTCTCATTTACCACCAAAGCTTTCGTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGA
ACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACAAAGGCAATGTTGGTCG
TGGTCAAGTTCCAGGCTCCGCGGTCGAATATCCACTGTGCCGTCAACTCGAGATCGCGCTCGCATGCTGCGCACCGCCACGTCGGAACGAATGAGAGGTC
AGCGGCTCTTCGACTCTGTCAGTCCTAGACTCTCAAACTCCCCCGGAACTCATGCATCCTGGTCTTCAACACGAATTCGTCGCGTTGACAGGCCCGCATT
CGCAGTAGCCTCAACTACGTCCTCGACTCCAAGCAGCTCCCGCAGCATTGCAAATCGCTGTGGTCCGAGCGCCTTGGTAAACATATCACCTATGTTGTCT
GCCGCAGGAACGTAGTTGAGGGTCAGCTCTTGATTTTCAACGAGCTCGGCGATCTTGTGACTTAACTTTGGAAATCGCTTCACACCCTCATAATTGCCCA
CATTCGCGCACACCTTCAACGTGCTCTGATTGTCACCGTACAGCTCGGGGACCAACGGCTTCATGCCTATTTCTTTGAGCAAATCTTGGGCCCAAAGCAG
GTCTTCCACACAAGTACTTGCTGCAGCCAATTCAGACATACACGTATCCGTCGTGACGCTTTTCTGCTTCTTACTTTTGAATCCAAAGTCGAAGCCGTTC
AGTTGAAGAACATACCCTGTCACCGACTTACTTTGTGTCCGGACAATTCGCGTGATCTGCATCACTAAATGCTCGCAGCTGAAGCTGCTGCTGTGGCACA
GCCTTCGATCTACGGTAGACCAAACCGAAAAATCTCGTACCGCGTAGGTACTGCAACACGCGCCTGGCGCTTGCATAATTTTCTTTCGTGTACGCTCCAG
CATGACGACTGAGACTCCGCACTGCATTGGCAATATCCGGACGCGTACAGGTAACCAAATACTGCAACTTGCCGACCAGTTCCCGGTAGGGAATCGACGC
ATCATTGATTTTGGTCCTGTCACGCTCCAACGGCAGTCCCGTCTCCTGCTGGGCCAACAACACGATCGAACAAGCGGTTGACAAGAGCGTGGACCCCGAC
CGTCGGTGTCGTGTGGACGGCGGCCCTTCTCTTCGACGTCTGAGAAGAATCTAGGGCGCCACTCTCTTCAAGCAGGTCCAGCAATGGGATCGAGTCAGTC
AGCTCAACAGGGACGTCCTTCGGCTGCACTGGCAAGGTAGTTAGCGGCGCTGCGCACAGCGACTCCTGCGTGATCAAGGCCAGAGCGAGCGCCAGTAGCG
GGCAAGTCATAAAGTCTTCGTCGGGAAAGAGCAACAGCGTCTGCTCGTCTGACGTCTTCACGCGGATGAAGTGGATAAAGAACACGCCATCAGCACCGAT
GGTGAGCAGCTGCTTTCGGACGAAGGTCATGTCCAAAGCGCGCCCGAAAATATACCACAAGAGGCATAGCAGTGCTGCATCTTGGTATTCTGATGCACAA
CAGACCGTTGAATACAGATAGCTTGTTATCTTCTTGAGATCACCCTTCGTGCATGCAACCTCTTTCAGAACGATCCCACCGCTCTCGCTGTTGATGCAGT
GCTGTTCAAGGGTATACCCCAAGCCGAGCAGCTGCCGGGCCACAGCTCCACCTTGAGCAGGGTACTTGTCGAGGAGCCAGCACTTCGCTTGGTGGAAATA
TTGAGCGACGGAGTGGCGCAACAAGTGCAGCCCCCTTGCTTGTGCAGGTACACACCGAACTTGTCCATCAGAGTCACTAGGATTCCCCCCGCGCGGCTTA
GGTCGGTAACGATCAAAGCCTTGACATGCTCCATGCTCGTGCCCTCGGCAGAGAGGAAGCGATTGAACTCCTTTATGGCTGTCGCGAGCGCGCTTGGTCT
TGGCGGGCTTCAAGCCGTTCCGGCTCATTGCTTTTGGTCGGAGAGGCGGTAAATATGCGAGTGATACGTGTCTCACCTCTCGCTTGTAGCATGATACACA
TATCTGGGCGTCAGCCCCGATCAGATATATCGGTATCGCTCAGCTTCCGATTGCAACGTGAAATTGTGTTTTTATTGGATAAAATAAAATCGTTGACGTG
ATTTGATTCGCCAAAAACTATAGTGATGGTTTTGATTTGCCAAAACGAATTAAAGAACAATCTCATTGGCTAATATCCACCATACTAAGATGAAGTTTGG
TCAGAGAGACATTGTTATTCATCCATGATCCAATTTTTGTCTGTACAGATAATCCTCTCAACTGTGGCAGCTTTGGGAGCCCGGGCCGGTTGCTTAAGGG
GCGATTGCTTACCCGAGCCGTTCCGACTCAGGGGGAGTGCAGTTCGGAAATCAATCGGGATACATATACAGACAATCAATTATGATATCCTGAATTGCGA
TCCGCTCCAGAAGCTGTTCCCAATGGCCGACGCTTTACAAAGTCAAGTCAGAAACGCCTCTACCCCTCGAATATAGATTGTAATGCAAAATGTTGGAATA
TCATTAACGAAAGGTGGTAACGATCCCATCCGTCCAAAGACGAATTCGGTTGTTTGCGGTCATTCTTTTGGCCTACCTCATCTGAAAAGCTGGCTGCATC
GCACGAAGTGCACTATCATCTCTAGAAGGCACGATTGCTTCGACCCCAACAAAAAGCAAAACCATATACGCAGGGATGTGACGTTCGCTAGTGGCTCTTA
AATGAAGCGATAATGTCTGCGCCGAGCGATTGGCACTTACTGGGGCAGCGTGCAGTTGGTTGAATGTACTGTGAGCGTTGGGTTGAAATTTTAGATATGA
ACTCGCTTGCGAAACCACTACATGTACCAGTCAAGCGAACATACCGTCGAGATACCTAGTTTATGGTACACTCTAGACGTAATGCCTCTTTTTCAGTAAT
AAACTGGTCACTAGTTTACTGTTATAATCCTTTTTCCTAACTTTTCTAGGAAAAAATCGGAGGACGAAGCCATCAAGCCTACCCGTTTGGAAGGAAAGTT
GCTCCTTGCTCAGACAGCTCCGTGGCTACTGCTCGAAACTGCCTAACGCCACTGCCTCCGTAGCTACATGTATTGCCGCTGACGTCTCCTCTTCTTCAAA
TACCATTCAGTTCCACTGAATCCACAGCCTTACGTCGTCACACAACACTACCGTGCATTCAGTTTTCATCTTGGATGCGATTCGTTTAACACTATCGAAA
GATCCCTACCGGACAGCACCCATGCAACACAGGACAAATGAAGTAGCTCAGCCTGGCAACGTGCCGCCGCCTGTCTAGTCGGACTTCTTGGTGGGCGTGG
GCAGCGTCTCGAGGTGGCGGAAGTAGTCGTCCAGGAACTGGAAGTACCAGGCCTGGTCGAACGTGCCGCGGAAGAAGTTGCACGAGATGTTGACTTCCAG
CAGGAGCACACCCAGGTTGGTGAGCGCTACATCCCAGCCGCAGAGCGGCACGTCCTTCATGAGCTTGAAGTGCGCCTCCTCTGCGAGCTCCTTCATTTGC
TTGATCTCCTTGATCACGTTGCCCGTGATGGGGACGCCCGTGTCCGGGTGGCTCGTGATGTCATGCCCCACGCTCAGGTTGCCACGGAACATGTGGTGCG
GGCCAACACGGTACCAGTGCGTCGTCGTGGAGCCCTTGAGGATTTTGCCTGACTCCATGTCCACGTCGAACATGATGGACTTGTGGTCGGTCGAGGCGCC
TTCCAGACCGGCACGGAACACACAGCTCAGCGACTTGACGCCGCTGCCGCCGTCCTTGAGCGCTTCAGCCTCACCCAGACCGTGGCGCGACGCTGTGATG
ATGCGGAAAGTCGAGAGGGGCGACACCTTCGGCAGCAGCTTCTTGAGGAACGGCGAGTTCTCGAGCTTCTCCTGGATGATCCAGTCGCCGCCGTCCACGG
CGTTCTTGAACATGTAGATGCCCATGCCTCCCTCCTCGTTGCGGTCCTTGATGACGAGCGAGCCGGGCGTCTTGAGGTAGGGCGACACGGCGATGCCGTT
CTTCTCGGCTTCGAGCAGGAAGTCCCACTTGTTCTCCATAATGTAACCGGGCGAGTTGGTCTTAAGGCTGTGCAGACTCACGACGTGGCAGTTGACGCGC
CAGAAGGCGAACCAGTTCTGCGGGCACACGAAGATCTGCGTGAAGGTGCGGATGAAGCGCTCAATGATGTTGCCCTCCTTGCTCGAGTAGGCCTTGGGCA
GCTCGAAGAAGGCGCCGATGGCGCACAGCCACGGGTACACGAAGAGCAGGAAGGGGAAGAGGATGACGCGCGAGTAGCTCACGATCGAGAGCGGCACGCC
CGTGCCGGGGATGGCCACGTTGCGCAGGTTGGTGACCAAGTCCTTGTAGAAGCTCGGGTGGCGGTAGTGCGGCTGGCTCCACAGCGGGTTCAGCAGCGCG
ATCGAGTACACGTACGTCTTGGCGTGCAGTTCGTCGGCGAAGAACGGGCAGTCGGCGTAGCTTCCTTGGCGCACCCAGTAGTACAGCAGCGAGCCGTAGA
AGCTCAGCAGCGCCTTGGAGGCGCCCACGCCGGCGGTGACGATGCCCATGACCATGGTTCCTCTTGCTTCGTTGGCTGGTCGGCTGGCTTGCGCGCGGCT
TGGTCGAAGGAGGAGTGAGCTGGCTTACGTCCGCTCGATTTGAAGCGATCCAAAACCGATGAGCGCAGCTGCTACGATCGCAGCCAATCAAAGTCAGTTG
GTGGGATCATGAATCATGATGTTTTCATCCGAAACGACTTGGCGTTTGTATGTGGAGAAGCAGTCGAGCAAAGCAGCTGGGATGCACGATGGTTTAACGG
AGCTTCGCTGGTATCGGAGGCGTCCACGTGCCGGCACGCAGGCTCGGCCTCAAGCTTTTCGCGACCAGCGTGCTGCTAGCACAGCCTAACGCGTGCACAC
GTGGACAGTCTCGACAACGAAGCAAGGGGGCGATCCCTGCTCTTCTGCCCTGGCACTTGTCGAGGGGGACGGCACCGTCGAAGAGGCCATGCTTATCGAC
GGCACCGGCGCTGAGGCGTTTGTGGTGCGGTGTGCTGTGCCGGTATGTGCTTCTTGCCCTGGCGTGGAATCTGCGGAATCTGCGGTGCATTGCGATGCCC
AGGAAAGCTAGCCACGCACGAGTCGAGACTGCACAGCGCCGGAGTTGCCAGCGACAGCAAGGCTGCACAACTTGACGCGTCATCATGAATGCCTCCATTG
TGGTGACCCCGTTGTCCAGGCGATGATCATCACCACTCCGTGCACAGCTTCATGGGACGAGGCGGCAGGCTTACCACGGTTTTAGTCAATTGGTTACGAC
GTTGCTCAATGTAAGTCACCCACGTGTGAATACTTTGCTGCTTTCCCGGCCCGACGCAAACGATAGATATATTTCTTTGCGAGCTGGCATGAGAAGGGCT
GCAACCAAATCGCGTGGGGCTAGCATTAGACGCTCCTGCGCGCGAGCTGCACGTTCAACCGCATCACAGGAAACTCAACCTGCAGGTATTTCGATAACCG
AGAACGGTTTCTCAATTTCATACTCGTTCGTGATCGTCCTGAGATGGCACACAGTCCCAGGGTCCGTTGCTGCTCGCATCAGTGAGCTGTGATCATATCA
ATCTCCATGGAAATCATAGTACAGTTTTGGGCTTACAGAACTGTGCACGTTCAGCGACTCCTTGCTCTGCAGACATTTTTTACCTCACACTAACTAACTG
TATGAGGCGTTTGCAAACGTGTTAGTCTGTTTGTGATTCCTACTTCGAAGTACAATGCTATTAAGTAACAGCTATGCGTGACTAATCAGGGTGTTCTTCG
AGATGAACTGCAGGAGAGCTGTCTTACGCCACCTGCGAGTTAGCTGTATTTGTTGTACACTAACAAACACTTCGCAAACAATGTTGGCAGCACTACCGTT
TGTGCGAACACTACCTTGGAGTAGCTGCCGAGCTACTTCGTTGTATATCTTTGAGGCATACATACTCTGGATCTCAACGAGTTGGGGCACTCGTACTAGT
CCGTGAACACGTCTACTCATTAAAATAGCCGCCTCGTGCCGATCTTGAAAAAGCTCAAATATTCAAGTACCTTTCACTCGCAATAAGCCGAATAACCCTC
ATATTAGAGTGTATTTTACAAAATATGTCAAGTATGCCCCCCCCCCCCCCCCCCACACACACACTCAAACACTTTGAGGGCTTGAAAATGTAGATTTTTT
TTTCAGGTCGCCGTCGTGCATCGAGTATTGACAGACGTATTTCCAATAGTGTGCTTAAATCGCGGTTCGTGCTAAGGTTCGTAAGCATCTTTTTGTTTGA
CGCAGATATCGTTGCTTTCGCTGTAGGTGTTGCGGGTTGTCGTTCGAGGCGACCTGCTCTTTGCCTCGGTGTCCGCCTAAGAAAGATACACACATACACA
CATGCACACAGATACATCGGGGCCGGAGGCCTTCTTCATCTTCCTGGCATGATTGCTTGACGCATAACGAAAAGGCCTGCCAATGCAACTCGTGCAGTCG
ATTGTTTTGTCGTAGTGATGTTACATGTCAAGTTAAGTGTTCTACAAGTACTTCAGCAATGAGCGTTGGCGCTGCATCTGTTATTTCATGACTGCATGGA
ACCTGGGAGGCCGAAATGTCTTCTGATAGGATAACTGCAGCTCTAGCATCTCCGAAGAGAGCTGGATCCAATCTTACGAAAGTGTCGGTCTGTCAACATT
ATCCATACAATAATGTGCCTGAACACATACTTCCACGTATTATTCGGCGGTCTGCAACTCTGTGCTGCGTTCTTGTCTGGCCTGGCCTGTAACTTGCGAG
AGGTGGACCTTGAGAAGTGGATCGGCGCCCACCTGCGCCGTGACACTTTCCAGTCGCATTGTGCGGACTGGAATTACGAAGTACTTGGCATCGTCCTGGG
CGACGTGCACAATACCCATCGTCCAACAGAATGCGCCAACTCTTCGCTCTCTGCTCCCAGGCTGAGCGTAGAGATAGCGTGGGCATGCATACAGCACTGT
ACCTGGCTGCAAACCGTTGCCACGCCATGTTTTCAGAGAGCAAGAAATCCCCCGAAGAACACACATCTTGTACGTGGTAGAATCCGTACAGATCATTCTA
TGTCACTGACTTGGAATTCGTATTGGACGCTTGGGTAAGTTTGCCAGGATGCCACTTCGTGCATTCTCAAATCTGTCGTGTAGCTGCTGGTGCTGAGTGA
TGTCGTCTCCGTCGTCGGCGAACCGGCGCAAGAGCAAGGCTGCGTGGTCCAAGGAGGACGACATCCGCCTGTGCCGCGCCTTCGTGCTGGCCACGCAGGA
CGGAGAAGGCACGGAGCACGTCAAGAACATGTGGACGCGGGTGCACACGCACTACGCGGCGCTGGTGGCGGACGAGGACCCGGGGGCCGCTCCTCGTGCC
GGTGGCGCGCTGCAGACCCACTGGTCGTCGTTCATCCGCCCGGAGTCGGCCTTCTTCGTGTCGCTCCTGGTGAAGGTGCGTAGTGATTCACTAGATTTGC
ATCTACCATTGAGTATTGACCGATTGTCCGACGCAGGTGGAGAAGGAAGAGCACGAAGGATGGAAGGAGGAGGACTGCCTGCTGGAGGCCAACAACCGCT
TCGAAGCCATCCGACAGGCCGAGGAAGTGGAGGCCGTGCGCGCGTACGAGGAGGCCAAGCAGCAAGCCGTGATCGAAGGGACGGAGCCGCCGTCCAAGCC
CCGACTCAAGGCCACGACGTTCCGCTACACTCACTGCATCCCGGCTTTGCGGACCAGCACACGCTTCATGCGCGCGGCCACGACAGAGAGGAAACCTCGA
GTGGTGCGCTCCCCGGTCCAGCGGCGACGTCGTCGACCGAAACTTCCTACTGACGCCGATGAGACGGTGGACGTGTCGGAAGCTTCCGACGACAGTATGA
GGTCGCACGATGGAGCGTCACCGCAGCACGGGCCTTCCCCGAAGCGACGTAAGGCAAGTGAAGCGTCCTCTGGTTCAGGATCGCGGTCGGGCTCGTCCTC
CTCGAGCTTGCCGAGTGATGATTCCAGCGACGAAGGCGTTCCTGCACCCAAGGGGTTTGCTATCCCTGTGGCGAACCAAGCACCGATGGTAGTGCCACCC
GTGGCCCGGGAGACCAGTGTTTCGCGCAGTGGCAATACTCGGAACGGAGGTCACTCGGTCAAGACGCACGCTCTGCAGACGCAGCAAAAGGCCAACTACC
GTCTAAAGCTGCTAACTGAGCTGCGTGGCATCGTGGAAACTATTTCGCAGCTGACGAACCAGCTCACTAATGGTACGGCGGTGCCGATGGGCATGGGGGC
TGCAACCCGACTGGATCCTATGTTGGTCGAGGAGGTGCAGCAGGACCTGCACTTCTTCCGCGATCAAAAGCGTCGTCTGAAGCAGGAGCTAGAGACGCTC
GACACGGCCGAAGGTCAGAATCGAGGAGAGTATGAACAGTAAATGTAGTTGGTCGATGAAGACACCCATGACACCATTGACGATGGTGGCATCCCAAAGT
CAAGTAACAATGTTTTTTTTCTTTCCAGTCTGATGACACGTGGAAGAGTATGATGCGACAACAAACGTGTGCGAAGAGTATCTGTGCGAAAAGTGCTTTT
GGAGCGAGTTCCTCTCCATCTTTTGCTCGTACGGTACCCAATGAATACTACTGAAACCTCGGTCTTAATTTTTGTATGGGGGGTTTCTGTGCATTGGAAT
CCCCCGATTCTATATTCATGCCTATTCTCCAAAACACTATTCTTCAAGCGAGTATGCGGCGAGGCAAAGAGCGCTGGACGCACGCGGATGACAAGCGGCT
GGGTCGCGCGCTTCTGGCCGTGTTCGCCAACCAGGGGGAGGTAGTGGTGCTAAGCGACAACTGCGCGCTCTGGAAACGCGTGCAGCAGCGCTACCAGGGG
CTCGTGGCGGCCGAGCAGGCAGTTGTGCCCGACGTGGCTCCGGCGCCGCGCAGTGCGCGTTCGCTGCACACGCGCTGGGCGCGCGGCATCCGCCCGGATA
TGATCCTGTTTGCGTCGCTCGTGGACAAGGTCTGTCGCCCAAATTTAAGAGGGTTTGGCGCTAGTGTAGACGGCTAACGAGTGAGTTGTGGACAGCTGCA
AAAGGCCGGCAAGAAGCCCACCAAGGCCGTCACGCAGGCCGTCAAGCTCTTCCGAGGCGAGCGCGGCGAAACCAACGCGGCGGCTGTGCGGCAGTTCGTT
CAGGCGCGACAGCAAACGCCGACGGCGGTCGGCACCGAGTCGGAGACGGACTCGTCGAGGCCCAAGCTCAAGTTCGAGTCGTTCCACTTCCGCCACTGCT
ACGACATCCTGCGCTCAAACCCCAAGTTCATTGAGGTGCTGTTGGAGGGCACTGTCAACGGAGAGAGCGGGCCTCGCAAACGTCGTCGCACAGAGGCGGG
CAGCGGCTCGGAGGACGAGTACAGCTCGTCGACGTCGAGCGACAACTCGGCCGATTCACATGAGGACGAGGTGCTGCTACAGGCACTGCCTTTTCGCCAT
AACCAGCTTGACAAGGCGGGTGTCATGAATCCGGAGCAAGTACACACGCTCCACCAGAGTTGGCAGAACCGCCAAGGCATTGCCAACGGCGTTCCGACGG
GAGCAAGAACTCTGGCTCGCGCTGCAAACGCACCTGCGCGCGAGTCTGGCAGCGTGATTATCACTATTGACGACGCAAACAACGACCTGGAGTTGCCGCG
CCTCGAGTGCGACCGCCAAGTGGCGAATGAGTACGTCCGTCTGCGGACGAAGACTCTGCAGGAAGATCGTCGCTTGAAGCTTCTGGGTGAACTCCGCGGT
GTCGTCACAACGATCTCGCAACTCTCACAGCAGCTCGCGTGGAACGGAGTGGCGTCGGCCGCCTTGGCAGCACGGACGGGGGCGGTCTGCCCCGCGCTGG
ATGAAGACGTACTACGCGATATCGCGTTCTTCCGTCACGAAAAGAATCGACTGAAGACGGAGATCACTGCCCTTGACGCGTGATGCTAACTTCATATGAA
GACTGGGTGGGGCTTGCGTAGGAACAGAGAAACAGAGCAGGAGATTATAAGGCTACGAAGCGCCCAATTGTCAAAGCAGTGATTGTATGTGTGAATACTT
GAAGAATCAATCGCTTGTCATTTCGAGCTCCTGTTGCAAATCGAACCGATAAGCGGCTCATAGACGCGCATCGCATTTCGTCGATCATGGCAGCTCGGAC
GTTGGCGCTGCTGCCGCTGGGCGGCTTGGTCGCCTGGAGCGGCAACGCGAAGCTCACGCGCATGCGCCACCAAGTGCGCGCGCCTCCCGGCGGCGAGGCG
CTCGAGTTCATTCCCGGGTCAATGGACGACACCATCATGGAGACGCTCGAGACGGGAGACTTGATTTTCTTCCAGCGCAAACTCACGGCCATGCAGCCGC
TGGCGGCGCTGCACACGTGGATCACTCGCCTACAGCTGCGTCCGCGCTTCGACCACTGCGGGTGGGTCTACGTGGACCGATTGGGCCGCAAGTTCATCGT
GGAGGAGACGCTGGACAAGGTGCAGTGTCGGCCATACAGCGCCCGACTGCTGACGTCCGAGGCCGCGGAGATCTCCGTGTTGACGCTGAAACTCGAGGTA
GAAAGTGTCTTTTGTATTGGTGGAGACGTTTCTCATTAATGGTCTTGTGGTGCAGAGGTCCAAGGAGATGCAGGAGGCCGCCAACGCCTTCATCGCCGAG
AACATGGGTCGAACGAGTCGCATCTCGGTGCGCCACACTGTCTCGGCACTGATTAGCCCCGAGGAAATGCGCGAGGCTGGGCTTGGCACAGCTCCTTCGT
TCCCCTGTGCAGGTGCGTGGCTGCTGCTTGGTTGTGGTTTTAGGTTGAAGCTGATCAGTCTTGGTGGCGCAGCTTTCATCGCTGAAGCGTATGGTGCTAT
GGGGCTTGTGAGCAAGGACCACCTAACAACCAGCCAACCTCCGCTGTCGGCTGCTACGATCACCCCACGCGACTTGGTGGCAAAGAAGATAAAGCTGCAG
GCTCCGACAGAGAAACAATCGGATGGAGCGAAGACACCAGCTTTTGGCCGCTTGCTCCCTATCAGGCTCGAGTAGACAGACACCTAGAAAAACGTCAACA
AAGGCAACGATATCCTTACAAGAGGGTTTATGCTTCCACTTCATTAATCCACAAGAGGAAGTCTAACAAACCGCTTCAGGCTCGCCTGCAGAGTTAACAT
ACCTAGCTCCATCACTCGATCGGTAGACACTTGGAGTGGAAGGCTTGTCCGTTCGCGTAGTCACGGAATGACGGAGGCACGTAAGCCCACTCCTCGCCCT
CCTTGACGAGCAGCTTCTTGCAGAAGGAGCAGGGTGTCTGGTAAATTTTGTCGTAGTAGCCAAGCCACGTGAAGAGATGGTAAAAGCATGTCTCCGGGTG
CTGCTTGCGGAAATGGTCCAGCGCCTTGCGGCCGTGCAGAGTTACAAGACGGAAGAGGTTGTGCGACGACTCCGACCACGCGCCGAGTGGAGCCTCCTCG
TTGTACGGCAAGATGGACAGTCGCTGGATGTACTTGGTGACCTGCAAGCCAGCGGCCCGAGCCTGTTCCTGCTCTTTAATGGCCTCGCGCGCCTCTGAGA
TGCGCTGCTTGAGCTCCTCCATCTCCATTTTCGTGGCTTCCTCCGCGGCAAGCTTGGCTTTTGAGAGCATGTCGCCCTTCTTCTTCTTGACGAGTTGCTG
CAGCTGCTTCTTGTGCTTGTTGCGAGTGCTGCGGAGGCGGCCACCGGCAAACGCCGGTGATGTGGGCGTGGATGGGGTCATGGGGCTGGCAGCCACGCCT
GTCTCGCCATTCGGGCCGTTCTCCGGAATGGGCGGGCAGAAGGACAGATGCACCGTCACTTCCTTGTTGATCTCGCACTTGATGGACTTGATGACTCGAC
GGCCGCCGCGCGTGGTCTCGGCGTGCTTGAAGAACTTGAGCTTGCGGTTCTTGGCCATCATGTAGTCCATCATCTCGTTGAGCGTGGCCGGCTGCTTCTC
TCCGAACGGGTCGAACACGCGGCCGCGTTTGTGGGACTTAGGCACGAAGAGGCTGCTGGGGGTGGGCGGGCAGCGGCCGTCACCCAGCATTTCGAGACGG
GGGAAGGCGCCGCCCAGCTGCTCCAGGTACACGGCCTGCGCCTTGGCGCCCATGTCCTGCACCTGGTTCTTCCAGTGGTACTCGAGCATGAGGTTGCGGT
GCGTCTGGTTCACGCTCTCGATGGGCTTCGTCTTTCCGTCTGCATTGGGGCACCCAGAGTCAGACAATA