Description :
From Genome Similarity Track
Location :
Scaffold_728:8792- 10010
Transcript NameFunction/comments
Phyta_totarag10400hypothetical protein

Sequence
1218 bases(100 bases per row)
GCCGTTCGCGATCGTGATTTTGTTCTCCAAGCCCGTCGGCTTATCCACGGCCGACACGTTCAGGATGCCGCTCGCGTCGATGTCGAACGTCACGTCGATC
TGCGGCACACAAGGCATGAGAGTGATGCCGTCCAGGTTAAGCTTGCCCAGCAGATTGTCATGGACCGCTCGCCTCAAACGCCTGGATGAGCACGCCCGGC
CGGATGTCCGCGTACGTCGAGAACGTCTGTGGCGTCTTGAGAGATACCGCCGTGCTACGTGTGATCAGTGTCGTCATGATGCCGCCCGCCGTCTCCAgac
ccagcgacagcgacgtcaaatccagtagcagcagatcctgctgcttgctcaaAGAGTCATTGCCGCTCAGGTTGACCGCCTGCACCGTGGCGCCGTACAG
CACTGCCTCATCCGAGCTGATCGCCTTGTTGAGCTCCTTTCCGTTAACGAAGttgtgacagcagcagctgcatcttgggGATACGAGTCGAgccgtccac
cagcaccacctcgtgcaTCTGTATTTTGGACAGCTTGGTACCTACTCCACAGGCTCCACCGCCGGAAGAAATCGCCACACAGGTCTTCTTAGCATGatgg
tcgagttgaagctcaCGCTGCGTACAGTGAGTCGATCGCTATGTTCGCCTGCGCCGATGACGACAGAGTAAGCATCCGAGCACGAGATTCTGTAATGGAG
GAACTGTAATAGACCGTGTTGAAGGCGTGATGGCGACCTACACGACGTGGAGAGCCAACGGTCTGCGGGCAGAATGCCGACGGTTAAAGGTTACCCTTGC
TTCCCTCAACAAAGCGCCGCTCTCAGAGCCTCACTCATCAAATCTGAAACTATCCAAGCAACTATGACATTTGGGAGGTTATGTCAATATCAAGAATTTC
TCGGTCTTAATTCTTATTTTGGGAGATTGGGACATTTCTTGTACGGGATTCGTCCCGTGAACACCGGGAATACCCCTTAGTACACACATACGCTACGTAC
AAACAGCGGAGAGCGAACTTGTTCTGCGTCAGAtccttgcgctgcttgcgctCGAACTCCCAGCACGAAGTCCTCGCCGCCGAGGTGCGTGTCACCCGCC
GTCGACTTCACTCCGAAGCTGTCCTCCTCAATGCTCAGCAGTGACACATCGAAAATGCcgtcgtccaggtcgaaGATCAGCACGGTGGGCTCGCCGCCAT
TCTTGTCCAGGCCGTACG