Description :
From Genome Similarity Track
Location :
Scaffold_1666:879- 3581
Sequence
2702 bases(100 bases per row)
AGCTCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAGTATCGGAGCTCGTGAAAGAGTCCGATATAGTAATCGCGCCTTTGATTCGTTAACGGATCAA
AGTGCTGCTCCTCCGCCACAGCATCATCGTGTACCCCGCTGCATACGTACAGCGGAATTTCATTTGGAGGCACGGTGTTGCCCGCACGGTCTGCGATCTC
TGACGCAGACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAGCTTGAAGGCGCCACCTCACGCGGGGAGCTTAAAGCCCCAGCAGCGGAG
AGCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTTGAAGCGTCCGAATCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTAT
CGCCGTCGATAGACTCCTTGCGCTTGTTGGAAGAGGCCTCGCCCTCTTCCATCTCCACGTCGTCGTCTTCGTAGTCAACGGCGTCGTTGACTACAGAGGA
ACCTTCGAGGACAATCTCCGACTGGGTTGTCCCCGACGCGGCCTTTGCAGCGAGCGCATCGCGCTTTGCCTGCTGGCGCTCATGGTACTGAGCAACAGAG
AGGTCACCCTCTGTTGCGGCGGCGGTCTTCTTCTGCGGCGAGCTCAGTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGATTGGT
CAATTTCCTGATTGACGTGCCGTGACTCGGCGCGTCTAACCTTGAGGGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGCCACTTGTAAC
TCTAACAGATACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGG
TCCATAGAGACTTAGGGTTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGAT
TCCTATCTTAGAATAATACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATCTTTTACCAAAACCCGCTACTTGGAGTCTTTATCTT
GTTTAAAGTATACTCGTGGATCTCGAGTATACTTAACTCAAGTAAAAGAAACCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAG
CC